Information report for AT5G17920
Gene Details
|
|
Functional Descriptions
- PO:0000282 — trichome — tricoma (Spanish, exact), 毛茸、糸状体、毛 (Japanese, exact), seta (related), setae (related), capilli (narrow), capillus (narrow), cilia (narrow), cilium (narrow), glochid (narrow), glochidia (narrow), glochidium (narrow), hair (narrow), lepides (narrow), lepis (narrow), non-secretory trichome (narrow), scale (narrow), squama (narrow), squamae (narrow), squamella (narrow), squamellae (narrow), squamule (narrow), barb trichome (broad), bristle (broad)
- PO:0005020 — vascular bundle — haz vascular (Spanish, exact), vein (exact), 維管束 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- atms1-1 — Mutants have reduced levels of H3K9me2 methylation.
Functional Keywords
Literature and News
- Arabidopsis microarrays identify conserved and differentially expressed genes involved in shoot growth and development from distantly related plant species. DOI: 10.1046/j.1365-313x.2003.01706.x ; PMID: 12662315
- The Arabidopsis root transcriptome by serial analysis of gene expression. Gene identification using the genome sequence. DOI: 10.1104/pp.103.030536 ; PMID: 14730065
- Target proteins of the cytosolic thioredoxins in Arabidopsis thaliana. DOI: 10.1093/pcp/pch019 ; PMID: 14749482
- The effect of alpha-amanitin on the Arabidopsis seed proteome highlights the distinct roles of stored and neosynthesized mRNAs during germination. DOI: 10.1104/pp.103.036293 ; PMID: 15047896
- Cell-specific protein profiling in Arabidopsis thaliana trichomes: identification of trichome-located proteins involved in sulfur metabolism and detoxification. DOI: 10.1016/j.phytochem.2004.03.026 ; PMID: 15276459
- Molecular phenotyping of the pal1 and pal2 mutants of Arabidopsis thaliana reveals far-reaching consequences on phenylpropanoid, amino acid, and carbohydrate metabolism. DOI: 10.1105/tpc.104.023705 ; PMID: 15377757
- Intron retention is a major phenomenon in alternative splicing in Arabidopsis. DOI: 10.1111/j.1365-313X.2004.02172.x ; PMID: 15341630
- A proteomic approach to apoplastic proteins involved in cell wall regeneration in protoplasts of Arabidopsis suspension-cultured cells. DOI: 10.1093/pcp/pci089 ; PMID: 15769804
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- The maize root transcriptome by serial analysis of gene expression. DOI: 10.1104/pp.104.057638 ; PMID: 15965024
- Patterns of protein oxidation in Arabidopsis seeds and during germination. DOI: 10.1104/pp.105.062778 ; PMID: 15908592
- Stress-induced protein S-glutathionylation in Arabidopsis. DOI: 10.1104/pp.104.058917 ; PMID: 16055689
- Elucidation of gene-to-gene and metabolite-to-gene networks in arabidopsis by integration of metabolomics and transcriptomics. DOI: 10.1074/jbc.M502332200 ; PMID: 15866872
- Identification of Arabidopsis salt and osmotic stress responsive proteins using two-dimensional difference gel electrophoresis and mass spectrometry. DOI: 10.1002/pmic.200401282 ; PMID: 16254930
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- A reference map of the Arabidopsis thaliana mature pollen proteome. DOI: 10.1016/j.bbrc.2005.09.185 ; PMID: 16242667
- Synthesis of the sulfur amino acids: cysteine and methionine. DOI: 10.1007/s11120-005-8810-9 ; PMID: 16307301
- Dynamics of Arabidopsis thaliana soluble proteome in response to different nutrient culture conditions. DOI: 10.1002/elps.200500561 ; PMID: 16358359
- Towards the proteome of Brassica napus phloem sap. DOI: 10.1002/pmic.200500155 ; PMID: 16400686
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Proteomic investigation of the effect of salicylic acid on Arabidopsis seed germination and establishment of early defense mechanisms. DOI: 10.1104/pp.106.082057 ; PMID: 16679420
- Downregulation of ClpR2 leads to reduced accumulation of the ClpPRS protease complex and defects in chloroplast biogenesis in Arabidopsis. DOI: 10.1105/tpc.106.042861 ; PMID: 16766689
- An expressed sequence tag (EST) library from developing fruits of an Hawaiian endemic mint (Stenogyne rugosa, Lamiaceae): characterization and microsatellite markers. DOI: 10.1186/1471-2229-6-16 ; PMID: 16928278
- Exploiting the wild crucifer Thlaspi arvense to identify conserved and novel genes expressed during a plant's response to cold stress. DOI: 10.1007/s11103-006-9080-4 ; PMID: 16972165
- Branched-chain aminotransferase4 is part of the chain elongation pathway in the biosynthesis of methionine-derived glucosinolates in Arabidopsis. DOI: 10.1105/tpc.105.039339 ; PMID: 17056707
- Proteomic analysis of seed dormancy in Arabidopsis. DOI: 10.1104/pp.106.087452 ; PMID: 17028149
- A hormone and proteome approach to picturing the initial metabolic events during Plasmodiophora brassicae infection on Arabidopsis. DOI: 10.1094/MPMI-19-1431 ; PMID: 17153927
- Distinct roles of the pepper hypersensitive induced reaction protein gene CaHIR1 in disease and osmotic stress, as determined by comparative transcriptome and proteome analyses. DOI: 10.1007/s00425-007-0628-6 ; PMID: 17899171
- Alternative and effective proteomic analysis in Arabidopsis. DOI: 10.1002/pmic.200700346 ; PMID: 17828791
- Proteome analysis of Arabidopsis leaf peroxisomes reveals novel targeting peptides, metabolic pathways, and defense mechanisms. DOI: 10.1105/tpc.107.050989 ; PMID: 17951448
- Comparative proteomic analysis of NaCl stress-responsive proteins in Arabidopsis roots. DOI: 10.1093/jxb/erm207 ; PMID: 17916636
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- Principal transcriptional programs regulating plant amino acid metabolism in response to abiotic stresses. DOI: 10.1104/pp.108.115733 ; PMID: 18375600
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Identification of zinc-responsive proteins in the roots of Arabidopsis thaliana using a highly improved method of two-dimensional electrophoresis. DOI: 10.1093/pcp/pcp154 ; PMID: 19880396
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- Alteration of mitochondrial protein complexes in relation to metabolic regulation under short-term oxidative stress in Arabidopsis seedlings. DOI: 10.1016/j.phytochem.2010.11.003 ; PMID: 21146842
- Species specific amino acid sequence-protein local structure relationships: An analysis in the light of a structural alphabet. DOI: 10.1016/j.jtbi.2011.01.047 ; PMID: 21333657
- Proteomic analyses of apoplastic proteins from germinating Arabidopsis thaliana pollen. DOI: 10.1016/j.bbapap.2011.07.013 ; PMID: 21798377
- A proteomics approach identifies novel proteins involved in gravitropic signal transduction. DOI: 10.3732/ajb.1200339 ; PMID: 23281391
- Proteome analysis of peroxisomes from etiolated Arabidopsis seedlings identifies a peroxisomal protease involved in β-oxidation and development. DOI: 10.1104/pp.113.223453 ; PMID: 24130194
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- PP2A-B'γ modulates foliar trans-methylation capacity and the formation of 4-methoxy-indol-3-yl-methyl glucosinolate in Arabidopsis leaves. DOI: 10.1111/tpj.13326 ; PMID: 27598402
- Methionine synthase 1 provides methionine for activation of the GLR3.5 Ca2+ channel and regulation of germination in Arabidopsis. DOI: 10.1093/jxb/erz431 ; PMID: 31563952
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Cell-specific protein profiling in Arabidopsis thaliana trichomes: identification of trichome-located proteins involved in sulfur metabolism and detoxification. DOI: 10.1016/j.phytochem.2004.03.026 ; PMID: 15276459
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- A reference map of the Arabidopsis thaliana mature pollen proteome. DOI: 10.1016/j.bbrc.2005.09.185 ; PMID: 16242667
- Synthesis of the sulfur amino acids: cysteine and methionine. DOI: 10.1007/s11120-005-8810-9 ; PMID: 16307301
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Proteomic survey of copper-binding proteins in Arabidopsis roots by immobilized metal affinity chromatography and mass spectrometry. DOI: 10.1002/pmic.200500108 ; PMID: 16526091
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- Proteome analysis of Arabidopsis leaf peroxisomes reveals novel targeting peptides, metabolic pathways, and defense mechanisms. DOI: 10.1105/tpc.107.050989 ; PMID: 17951448
- Comparative proteomic analysis of NaCl stress-responsive proteins in Arabidopsis roots. DOI: 10.1093/jxb/erm207 ; PMID: 17916636
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. DOI: 10.1016/j.phytochem.2008.04.007 ; PMID: 18538804
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Cell-specific protein profiling in Arabidopsis thaliana trichomes: identification of trichome-located proteins involved in sulfur metabolism and detoxification. DOI: 10.1016/j.phytochem.2004.03.026 ; PMID: 15276459
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- A reference map of the Arabidopsis thaliana mature pollen proteome. DOI: 10.1016/j.bbrc.2005.09.185 ; PMID: 16242667
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- Proteome analysis of Arabidopsis leaf peroxisomes reveals novel targeting peptides, metabolic pathways, and defense mechanisms. DOI: 10.1105/tpc.107.050989 ; PMID: 17951448
- Comparative proteomic analysis of NaCl stress-responsive proteins in Arabidopsis roots. DOI: 10.1093/jxb/erm207 ; PMID: 17916636
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. DOI: 10.1016/j.phytochem.2008.04.007 ; PMID: 18538804
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A654G2F8
- EMBL: CACRSJ010000110, LR881470
- AlphaFoldDB: A0A654G2F8
- EnsemblPlants: AT5G17920.1, AT5G17920.2
- Gramene: AT5G17920.1, AT5G17920.2
- KEGG: ath:AT5G17920
- Orthologous matrix: KVMKGML
- ExpressionAtlas: AT5G17920
- InterPro: IPR002629, IPR006276, IPR013215
- PANTHER: PTHR30519
- SUPFAM: SSF51726
- Gene3D: 3.20.20.210
- SWISS-MODEL: A0A654G2F8
- Conserved Domain Database: cd03311, cd03312
Sequences
cDNA Sequence
- >AT5G17920.1
GAGCACCACCAGATCTACAGAAATGACACAGAGCCCAACGATGATGTATCTCGTTTATTTTCGCTATAAATAAACTCACACAGCCCACTCTTCTTCCTCGCTCTCTCTTTCGCCTTCTCTTAGCCTACCCTTTTTCCTTCCTCCTCTCCGATTCTTCCTCCGTCAGTAAAAGAAAATCAAAATGGCTTCACACATTGTTGGATACCCACGTATGGGCCCTAAGAGAGAGCTCAAGTTTGCATTGGAATCTTTCTGGGATGGTAAGAGCACTGCTGAGGATCTTCAGAAGGTGTCTGCTGATCTCAGGTCATCCATCTGGAAACAGATGTCTGCCGCTGGGACTAAGTTCATCCCTAGCAACACCTTTGCTCACTACGACCAGGTTCTTGACACCACCGCCATGCTCGGTGCTGTTCCACCTAGGTATGGATACACTGGTGGTGAGATCGGCCTTGATGTTTACTTCTCCATGGCTAGAGGAAATGCCTCTGTGCCTGCCATGGAAATGACCAAGTGGTTCGACACCAACTACCATTACATCGTCCCTGAGTTGGGCCCTGAGGTTAACTTCTCTTACGCATCCCACAAGGCGGTGAATGAGTACAAGGAGGCCAAGGCTCTTGGTGTTGACACCGTCCCTGTACTTGTTGGCCCAGTCTCTTACTTGCTGCTTTCCAAGGCTGCCAAGGGTGTTGACAAGTCATTCGAACTTCTTTCTCTTCTCCCTAAGATTCTCCCGATCTACAAGGAAGTGATTACCGAGCTTAAGGCTGCTGGTGCCACCTGGATTCAGCTTGACGAGCCTGTCCTTGTTATGGATCTTGAGGGTCAGAAACTCCAGGCCTTTACTGGTGCCTATGCTGAACTTGAATCAACTCTTTCTGGTTTGAATGTTCTTGTCGAGACCTACTTCGCTGATATCCCTGCTGAGGCATACAAGACCCTAACCTCATTGAAGGGTGTGACTGCCTTTGGATTTGATTTGGTTCGTGGCACCAAGACCCTTGATTTGGTCAAGGCAGGTTTCCCTGAGGGAAAGTACCTCTTTGCTGGTGTTGTTGATGGAAGGAACATCTGGGCCAACGACTTTGCTGCGTCCCTAAGCACCTTGCAGGCACTTGAAGGCATTGTTGGTAAAGACAAGCTTGTGGTCTCAACCTCCTGCTCTCTTCTCCACACCGCTGTTGATCTTATCAATGAGACTAAGCTTGATGATGAAATCAAGTCATGGTTGGCGTTTGCTGCCCAGAAGGTCGTTGAAGTGAACGCTTTGGCCAAGGCTTTGGCTGGTCAGAAGGACGAGGCTCTTTTCTCTGCCAATGCTGCGGCTTTGGCTTCAAGGAGATCTTCCCCAAGAGTCACCAACGAGGGTGTCCAGAAGGCTGCTGCTGCTTTGAAGGGATCTGACCACCGTCGTGCAACCAATGTTAGTGCTAGGCTAGATGCTCAGCAGAAGAAGCTCAATCTCCCAATCCTACCAACCACAACCATTGGATCCTTCCCACAGACTGTAGAGCTCAGGAGAGTTCGTCGTGAGTACAAGGCCAAAAAGGTCTCAGAGGAGGACTACGTTAAAGCCATCAAGGAAGAGATCAAGAAAGTTGTTGACCTCCAAGAGGAACTTGACATCGATGTTCTTGTCCACGGAGAGCCAGAGAGAAACGACATGGTTGAGTACTTTGGTGAGCAGTTGTCTGGTTTTGCCTTCACTGCAAACGGATGGGTCCAATCTTATGGATCTCGCTGTGTGAAGCCACCAGTTATCTATGGTGATGTGAGCCGTCCCAAGGCAATGACCGTCTTCTGGTCCGCAATGGCTCAGAGCATGACCTCTCGCCCAATGAAGGGTATGCTTACTGGTCCCGTCACCATTCTCAACTGGTCCTTTGTCAGGAACGACCAGCCCAGGCACGAAACCTGTTACCAGATCGCTTTGGCCATCAAGGACGAAGTCGAGGATCTTGAGAAAGGTGGAATCGGTGTCATTCAGATTGATGAGGCTGCACTTAGAGAAGGACTACCACTCAGGAAATCCGAGCATGCTTTCTACTTGGACTGGGCCGTCCACTCCTTCAGAATCACCAACTGTGGAGTCCAAGACAGCACCCAGATCCACACTCACATGTGCTACTCCCACTTCAATGACATCATACACTCCATCATCGACATGGATGCTGATGTCATCACCATTGAGAACTCCAGGTCTGATGAGAAGCTTCTTTCCGTGTTCCGTGAAGGAGTGAAGTACGGTGCTGGAATCGGTCCAGGAGTCTACGACATCCACTCTCCAAGAATACCATCTTCTGAGGAAATCGCAGACAGGGTCAACAAGATGCTTGCTGTCCTAGAGCAGAACATCCTTTGGGTTAACCCTGACTGTGGTCTCAAGACCCGTAAGTACACCGAGGTCAAGCCTGCACTCAAGAACATGGTTGATGCGGCTAAGCTCATCCGCTCCCAGCTCGCCAGTGCCAAGTGAAGAAAAGCTTGATTTGAACAAGGAAACGTTTTTTTTTCTCTAAAATGGTTGTGTTTTATTTGGTTTAATAACTTTCTTAAAAATATTTTTAGTCGAAGGTAGATTTGATGCATATGGTTTCTTTCTTGTTGAGAGAGAGAAAGGCTATAGCATCCTTTGGATTTGATGCAATGTTTGTGATTTTCTTTTTGTCTCCAATATATTTCTCTGATGGAATGTCTTTTTTCTAAAGTATCTTGAAAAGGAATAAGAGGATTGATTCTTATACAAATACTTTTGTTTGCGTTGTCCTAAACTCACTACTTTTTTTTATCCGACGCAATCAGTGCTTTGTAGCCTGTTCTTGAAGTAGGCCCCTTTGTATGTCTCTATCTGGCTCCTGTATCAGATTGTTGTTTCCCTTAGATTTCTTTATTTCGTTGGCAAAAAGAAAATCTGAATTGCCCCACAAAGAGCGTGGTGGCTGATGTTAGGTTGCAGTCTCATGGTCCACCACTTTAGACTCGAAGATTTATTTCGCTTGGAGAACATCTTCGTTGATGTTTATGTATCATTTGAACTGTAGACTGTAGCCAAGTAGAAGGTTTTAACTCTGTAAAATCTGAGATGTTGTATGTTCTCAAGTTTTATCTCAGTAATTCAAGTCTCTTTGAGTTCAAATAAGAAAAAG - >AT5G17920.2
GAGCACCACCAGATCTACAGAAATGACACAGAGCCCAACGATGATGTATCTCGTTTATTTTCGCTATAAATAAACTCACACAGCCCACTCTTCTTCCTCGCTCTCTCTTTCGCCTTCTCTTAGCCTACCCTTTTTCCTTCCTCCTCTCCGATTCTTCCTCCGTCAGTAAAAGAAAATCAAAATGGCTTCACACATTGTTGGATACCCACGTATGGGCCCTAAGAGAGAGCTCAAGTTTGCATTGGAATCTTTCTGGGATGGTAAGAGCACTGCTGAGGATCTTCAGAAGGTGTCTGCTGATCTCAGGTCATCCATCTGGAAACAGATGTCTGCCGCTGGGACTAAGTTCATCCCTAGCAACACCTTTGCTCACTACGACCAGGTTCTTGACACCACCGCCATGCTCGGTGCTGTTCCACCTAGGTATGGATACACTGGTGGTGAGATCGGCCTTGATGTTTACTTCTCCATGGCTAGAGGAAATGCCTCTGTGCCTGCCATGGAAATGACCAAGTGGTTCGACACCAACTACCATTACATCGTCCCTGAGTTGGGCCCTGAGGTTAACTTCTCTTACGCATCCCACAAGGCGGTGAATGAGTACAAGGAGGCCAAGGCTCTTGGTGTTGACACCGTCCCTGTACTTGTTGGCCCAGTCTCTTACTTGCTGCTTTCCAAGGCTGCCAAGGGTGTTGACAAGTCATTCGAACTTCTTTCTCTTCTCCCTAAGATTCTCCCGATCTACAAGGAAGTGATTACCGAGCTTAAGGCTGCTGGTGCCACCTGGATTCAGCTTGACGAGCCTGTCCTTGTTATGGATCTTGAGGGTCAGAAACTCCAGGCCTTTACTGGTGCCTATGCTGAACTTGAATCAACTCTTTCTGGTTTGAATGTTCTTGTCGAGACCTACTTCGCTGATATCCCTGCTGAGGCATACAAGACCCTAACCTCATTGAAGGGTGTGACTGCCTTTGGATTTGATTTGGTTCGTGGCACCAAGACCCTTGATTTGGTCAAGGCAGGTTTCCCTGAGGGAAAGTACCTCTTTGCTGGTGTTGTTGATGGAAGGAACATCTGGGCCAACGACTTTGCTGCGTCCCTAAGCACCTTGCAGGCACTTGAAGGCATTGTTGGTAAAGACAAGCTTGTGGTCTCAACCTCCTGCTCTCTTCTCCACACCGCTGTTGATCTTATCAATGAGACTAAGCTTGATGATGAAATCAAGTCATGGTTGGCGTTTGCTGCCCAGAAGGTCGTTGAAGTGAACGCTTTGGCCAAGGCTTTGGCTGGTCAGAAGGACGAGGCTCTTTTCTCTGCCAATGCTGCGGCTTTGGCTTCAAGGAGATCTTCCCCAAGAGTCACCAACGAGGGTGTCCAGAAGGCTGCTGCTGCTTTGAAGGGATCTGACCACCGTCGTGCAACCAATGTTAGTGCTAGGCTAGATGCTCAGCAGAAGAAGCTCAATCTCCCAATCCTACCAACCACAACCATTGGATCCTTCCCACAGACTGTAGAGCTCAGGAGAGTTCGTCGTGAGTACAAGGCCAAAAAGGTCTCAGAGGAGGACTACGTTAAAGCCATCAAGGAAGAGATCAAGAAAGTTGTTGACCTCCAAGAGGAACTTGACATCGATGTTCTTGTCCACGGAGAGCCAGAGAGAAACGACATGGTTGAGTACTTTGGTGAGCAGTTGTCTGGTTTTGCCTTCACTGCAAACGGATGGGTCCAATCTTATGGATCTCGCTGTGTGAAGCCACCAGTTATCTATGGTGATGTGAGCCGTCCCAAGGCAATGACCGTCTTCTGGTCCGCAATGGCTCAGAGCATGACCTCTCGCCCAATGAAGGGTATGCTTACTGGTCCCGTCACCATTCTCAACTGGTCCTTTGTCAGGAACGACCAGCCCAGGCACGAAACCTGTTACCAGATCGCTTTGGCCATCAAGGACGAAGTCGAGGATCTTGAGAAAGGTGGAATCGGTGTCATTCAGATTGATGAGGCTGCACTTAGAGAAGGACTACCACTCAGGAAATCCGAGCATGCTTTCTACTTGGACTGGGCCGTCCACTCCTTCAGAATCACCAACTGTGGAGTCCAAGACAGCACCCAGATCCACACTCACATGTGCTACTCCCACTTCAATGACATCATACACTCCATCATCGACATGGATGCTGATGTCATCACCATTGAGAACTCCAGGTCTGATGAGAAGCTTCTTTCCGTGTTCCGTGAAGGAGTGAAGTACGGTGCTGGAATCGGTCCAGGAGTCTACGACATCCACTCTCCAAGAATACCATCTTCTGAGGAAATCGCAGACAGGGTCAACAAGATGCTTGCTGTCCTAGAGCAGAACATCCTTTGGGTTAACCCTGACTGTGGTCTCAAGACCCGTAAGTACACCGAGGTCAAGCCTGCACTCAAGAACATGGTTGATGCGGCTAAGCTCATCCGCTCCCAGCTCGCCAGTGCCAAGTGAAGAAAAGCTTGATTTGAACAAGGAAACGTTTTTTTTTCTCTAAAATGGTTGTGTTTTATTTGGTTTAATAACTTTCTTAAAAATATTTTTAGTCGAAGGTAGATTTGATGCATATGGTTTCTTTCTTGTTGAGAGAGAGAAAGGCTATAGCATCCTTTGGATTTGATGCAATGTTTGTGATTTTCTTTTTGTCTCCAATATATTTCTCTGATGGAATGTCTTTTTTCTAAAGTATCTTGAAAAGGAATAAGAGGATTGATTCTTATACAAATACTTTTGTTTGCGTTGTCCTAAACTCACTACTTTTTTTTATCCGACGCAATCAGTGCTTTGTAGCCTGTTCTTGAAGTAGGCCCCTTTGTATGTCTCTATCTGGCTCCTGTATCAGATTGTTGTTTCCCTTAGATTTCTTTATTTCGTTGGCAAAAAGAAAATCTGAATTGCCCCACAAAGAGCGTGGTGGCTGATGTTAGGTTGCAGTCTCATGGTCCACCACTTTAGACTCGAAGATTTATTTCGCTTGGAGAACATCTTCGTTGATGTTTATGTATCATTTGAACTGTAGACTGTAGCCAAGTAGAAGGTTTTAACTCTGTAAAATCTGAGATGTTGTATGTTCTCAAGTTTTATCTCAGTAATTCAAGTCTCTTTGAGTTCAAATAAGAAAAAG
CDS Sequence
Protein Sequence