Information report for AT5G17490
Gene Details
|
|
Functional Descriptions
- PO:0009049 — inflorescence — inflorescencia (Spanish, exact), 花序 (Japanese, exact), Triticeae spike (narrow)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- GO:0009863 — involved in — salicylic acid mediated signaling pathway
- GO:2000693 — acts upstream of or within — positive regulation of seed maturation
- GO:0005515 — enables — protein binding
- GO:0009867 — involved in — jasmonic acid mediated signaling pathway
- GO:0010431 — acts upstream of or within — seed maturation
- GO:0009740 — acts upstream of or within — gibberellic acid mediated signaling pathway
- GO:0009739 — acts upstream of or within — response to gibberellin
- GO:0010187 — involved in — negative regulation of seed germination
- GO:0042538 — involved in — hyperosmotic salinity response
- GO:0009938 — involved in — negative regulation of gibberellic acid mediated signaling pathway
- GO:2000033 — involved in — regulation of seed dormancy process
- GO:0006355 — involved in — regulation of DNA-templated transcription
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0043565 — enables — sequence-specific DNA binding
- GO:0005634 — located in — nucleus
- GO:0009723 — involved in — response to ethylene
- GO:2000377 — involved in — regulation of reactive oxygen species metabolic process
- GO:0005634 — is active in — nucleus
- GO:0009737 — involved in — response to abscisic acid
Functional Keywords
Literature and News
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Synergistic derepression of gibberellin signaling by removing RGA and GAI function in Arabidopsis thaliana. DOI: 10.1093/genetics/159.2.777 ; PMID: 11606552
- Arabidopsis RGL1 encodes a negative regulator of gibberellin responses. DOI: 10.1105/tpc.010325 ; PMID: 11826301
- Della proteins and gibberellin-regulated seed germination and floral development in Arabidopsis. DOI: 10.1104/pp.104.039578 ; PMID: 15173565
- Identification and characterization of Arabidopsis gibberellin receptors. DOI: 10.1111/j.1365-313X.2006.02748.x ; PMID: 16709201
- DELLA-mediated cotyledon expansion breaks coat-imposed seed dormancy. DOI: 10.1016/j.cub.2006.10.057 ; PMID: 17141619
- Identification of conserved tyrosine residues important for gibberellin sensitivity of Arabidopsis RGL2 protein. DOI: 10.1007/s00425-007-0497-z ; PMID: 17333251
- Elucidating the germination transcriptional program using small molecules. DOI: 10.1104/pp.107.110841 ; PMID: 18359847
- A DELLA in disguise: SPATULA restrains the growth of the developing Arabidopsis seedling. DOI: 10.1105/tpc.110.082594 ; PMID: 21478445
- Phytosphingosine-phosphate is a signal for AtMPK6 activation and Arabidopsis response to chilling. DOI: 10.1111/j.1469-8137.2011.04017.x ; PMID: 22236066
- The Arabidopsis DELLA RGA-LIKE3 is a direct target of MYC2 and modulates jasmonate signaling responses. DOI: 10.1105/tpc.112.101428 ; PMID: 22892320
- DELLA proteins and their interacting RING Finger proteins repress gibberellin responses by binding to the promoters of a subset of gibberellin-responsive genes in Arabidopsis. DOI: 10.1105/tpc.112.108951 ; PMID: 23482857
- Differential control of seed primary dormancy in Arabidopsis ecotypes by the transcription factor SPATULA. DOI: 10.1073/pnas.1301647110 ; PMID: 23754415
- DELLA-interacting SWI3C core subunit of switch/sucrose nonfermenting chromatin remodeling complex modulates gibberellin responses and hormonal cross talk in Arabidopsis. DOI: 10.1104/pp.113.223933 ; PMID: 23893173
- PIF3 is involved in the primary root growth inhibition of Arabidopsis induced by nitric oxide in the light. DOI: 10.1093/mp/sst142 ; PMID: 24157606
- Melatonin mediates the stabilization of DELLA proteins to repress the floral transition in Arabidopsis. DOI: 10.1111/jpi.12320 ; PMID: 26887824
- Integration of auxin/indole-3-acetic acid 17 and RGA-LIKE3 confers salt stress resistance through stabilization by nitric oxide in Arabidopsis. DOI: 10.1093/jxb/erw508 ; PMID: 28158805
- Salt hypersensitive mutant 9, a nucleolar APUM23 protein, is essential for salt sensitivity in association with the ABA signaling pathway in Arabidopsis. DOI: 10.1186/s12870-018-1255-z ; PMID: 29490615
- DELLA proteins negatively regulate dark-induced senescence and chlorophyll degradation in Arabidopsis through interaction with the transcription factor WRKY6. DOI: 10.1007/s00299-018-2282-9 ; PMID: 29574486
- The Transcription Factor INDUCER OF CBF EXPRESSION1 Interacts with ABSCISIC ACID INSENSITIVE5 and DELLA Proteins to Fine-Tune Abscisic Acid Signaling during Seed Germination in Arabidopsis. DOI: 10.1105/tpc.18.00825 ; PMID: 31123050
- DELLA and EDS1 Form a Feedback Regulatory Module to Fine-Tune Plant Growth-Defense Tradeoff in Arabidopsis. DOI: 10.1016/j.molp.2019.07.006 ; PMID: 31382023
- GAI Functions in the Plant Response to Dehydration Stress in Arabidopsis thaliana. DOI: 10.3390/ijms21030819 ; PMID: 32012796
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
- Coordinated regulation of Arabidopsis thaliana development by light and gibberellins. DOI: 10.1038/nature06448 ; PMID: 18216856
- SOMNUS, a CCCH-type zinc finger protein in Arabidopsis, negatively regulates light-dependent seed germination downstream of PIL5. DOI: 10.1105/tpc.108.058859 ; PMID: 18487351
Gene Resources
Sequences
cDNA Sequence
- >AT5G17490.1
TGGGTATTAAAAAATAGTTTAATAGACTATGACAGTCCATTGGACCATTAAACAAAAACTACACGCCCTTATCAGAGCGACGAATTTTTTGTAACTTGGATCAGAAATTCAATAAAGTTATAGTAATAAAAATGAAATAATTTGGAAAAGAAAGAATAGAGAAGAAAACACATGCGAAATTATAATGGCCTGCCTCTCTTCCTTCTTATCTCTTTTACTTACACTCTCCAGGTCCCTCACTTCCCTCATTGGACCTCTCTAACTCTCCTCTCTTACCTTCTCCTGTTTAAATTCTTCTCCTTTCTTTCCACAATTTCTGTCTAACCAATTCCAACACCAAAAAATTCCATTTCTTGACGATGAAACGAAGCCATCAAGAAACGTCTGTAGAAGAAGAAGCTCCTTCAATGGTGGAGAAGTTAGAAAATGGTTGTGGTGGTGGTGGAGACGATAACATGGACGAGTTTCTTGCTGTTTTGGGTTACAAGGTTCGATCTTCAGACATGGCAGATGTTGCACAGAAGCTTGAACAGCTTGAAATGGTCTTGTCCAATGATATTGCCTCTTCTAGTAATGCCTTCAATGACACCGTTCATTACAATCCTTCTGATCTCTCCGGTTGGGCTCAGAGCATGCTCTCGGATCTTAATTACTACCCGGATCTTGACCCGAACCGGATTTGCGATCTGAGACCAATCACAGACGACGATGAGTGTTGCAGTAGCAATAGTAACAGCAACAAGAGGATTCGACTCGGTCCTTGGTGTGACTCAGTGACCAGCGAGTCAACTCGTTCCGTGGTGCTTATCGAGGAGACAGGAGTTAGACTCGTTCAGGCGCTAGTGGCCTGCGCCGAGGCGGTTCAGCTGGAGAATCTGAGCCTCGCGGATGCTCTCGTCAAGCGCGTGGGATTACTCGCGGCTTCTCAAGCCGGAGCCATGGGGAAAGTCGCTACCTACTTCGCCGAAGCCCTAGCTCGTCGAATTTACCGGATTCATCCTTCCGCCGCCGCCATTGATCCTTCCTTCGAAGAGATTCTTCAGATGAACTTCTACGACTCGTGTCCCTACCTGAAATTCGCTCATTTCACGGCCAATCAGGCGATTCTAGAAGCTGTTACGACGTCGCGTGTCGTACACGTAATCGATCTAGGGCTTAATCAAGGTATGCAATGGCCGGCGTTAATGCAAGCCTTAGCTCTCCGACCCGGTGGTCCACCGTCGTTTCGTCTCACCGGCGTTGGGAATCCGTCGAATCGAGAAGGGATTCAAGAGTTAGGTTGGAAGCTAGCTCAGCTGGCTCAAGCCATCGGCGTCGAATTCAAATTCAATGGTCTAACGACGGAGAGGTTATCCGATTTAGAACCGGATATGTTCGAGACCCGAACCGAATCGGAGACTCTAGTGGTTAATTCGGTTTTCGAGCTTCACCCGGTTTTATCCCAACCCGGTTCGATCGAAAAGCTGTTAGCGACGGTTAAGGCGGTTAAACCGGGTCTCGTAACAGTGGTGGAACAAGAAGCGAACCATAACGGTGACGTTTTCTTAGACCGGTTTAACGAAGCGCTTCACTATTACTCGAGCTTGTTCGACTCGCTCGAAGATGGTGTTGTGATACCGAGTCAAGACCGAGTCATGTCGGAGGTTTACTTAGGGAGACAGATATTGAACTTGGTGGCGACGGAAGGAAGCGATAGGATCGAGCGACACGAGACGCTGGCTCAGTGGCGAAAACGTATGGGATCCGCCGGGTTTGACCCGGTTAACCTCGGATCAGACGCGTTTAAGCAAGCGAGTTTGCTATTGGCGTTATCTGGCGGTGGAGATGGATACAGAGTGGAGGAGAACGACGGAAGCCTAATGCTTGCGTGGCAAACGAAACCTCTAATCGCTGCATCGGCGTGGAAACTAGCGGCGGAGTTGCGGCGGTAGATACGTCGTCATAAAGAGGAGAAGAAAAAAGACTTAGCGAACGTGACCTTATGTTTTTATTTTACTTTAACTTACCCCAGTAGTTTCGTTTTGTGACAATTTCGCCCGAAATATTCCGTGCCTTATACTTTTGGGACCCAGTTGGTTCGTTGGTCGTGGAGATTCGAGAACGAGGAACATGTGTGTATGTAACAACAGCACGAGCAAGTGTTTTCATAGTTTGAATAAATATGAAAGAAATGACGTTTATTTTATTTTTTGTCAACGAATTGACGTTACGTTTAATTTCACCCAAAATATATACAAAATGACGCATGAATGAATTTG
CDS Sequence
Protein Sequence