Information report for AT5G17220
Gene Details
|
|
Functional Descriptions
- GO:0009407 — acts upstream of or within — toxin catabolic process
- GO:0043169 — enables — cation binding
- GO:0005737 — is active in — cytoplasm
- GO:0004364 — enables — glutathione transferase activity
- GO:0043295 — enables — glutathione binding
- GO:0005634 — located in — nucleus
- GO:0009705 — located in — plant-type vacuole membrane
- GO:0006749 — involved in — glutathione metabolic process
- GO:1900384 — acts upstream of or within — regulation of flavonol biosynthetic process
Functional Keywords
Literature and News
- Probing the diversity of the Arabidopsis glutathione S-transferase gene family. DOI: 10.1023/a:1015557300450 ; PMID: 12090627
- Large-scale identification of leaf senescence-associated genes. DOI: 10.1046/j.1365-313x.2003.01908.x ; PMID: 14617064
- When defense pathways collide. The response of Arabidopsis to a combination of drought and heat stress. DOI: 10.1104/pp.103.033431 ; PMID: 15047901
- Responses of primary and secondary metabolism to sugar accumulation revealed by microarray expression analysis of the Arabidopsis mutant, pho3. DOI: 10.1093/jxb/erh143 ; PMID: 15133053
- Molecular phenotyping of the pal1 and pal2 mutants of Arabidopsis thaliana reveals far-reaching consequences on phenylpropanoid, amino acid, and carbohydrate metabolism. DOI: 10.1105/tpc.104.023705 ; PMID: 15377757
- Functional genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing an MYB transcription factor. DOI: 10.1111/j.1365-313X.2005.02371.x ; PMID: 15807784
- Analysis of the female gametophyte transcriptome of Arabidopsis by comparative expression profiling. DOI: 10.1104/pp.105.067314 ; PMID: 16299181
- A coumaroyl-ester-3-hydroxylase insertion mutant reveals the existence of nonredundant meta-hydroxylation pathways and essential roles for phenolic precursors in cell expansion and plant growth. DOI: 10.1104/pp.105.069690 ; PMID: 16377748
- A UV-B-specific signaling component orchestrates plant UV protection. DOI: 10.1073/pnas.0507187102 ; PMID: 16330762
- MAX1, a regulator of the flavonoid pathway, controls vegetative axillary bud outgrowth in Arabidopsis. DOI: 10.1073/pnas.0509463102 ; PMID: 16387852
- Anthocyaninless1 gene of Arabidopsis thaliana encodes a UDP-glucose:flavonoid-3-O-glucosyltransferase. DOI: 10.1007/s10265-006-0067-7 ; PMID: 17277900
- Impact of AtNHX1, a vacuolar Na+/H+ antiporter, upon gene expression during and long-term salt stress in Arabidopsis thaliana. DOI: 10.1186/1471-2229-7-18 ; PMID: 17411438
- Transcription factor AtDOF4;2 affects phenylpropanoid metabolism in Arabidopsis thaliana. DOI: 10.1111/j.1469-8137.2007.02129.x ; PMID: 17635218
- MYC2 differentially modulates diverse jasmonate-dependent functions in Arabidopsis. DOI: 10.1105/tpc.106.048017 ; PMID: 17616737
- The Arabidopsis MATE transporter TT12 acts as a vacuolar flavonoid/H+ -antiporter active in proanthocyanidin-accumulating cells of the seed coat. DOI: 10.1105/tpc.106.046029 ; PMID: 17601828
- Simultaneous interaction of Arabidopsis thaliana with Bradyrhizobium Sp. strain ORS278 and Pseudomonas syringae pv. tomato DC3000 leads to complex transcriptome changes. DOI: 10.1094/MPMI-21-2-0244 ; PMID: 18184068
- The absence of ALTERNATIVE OXIDASE1a in Arabidopsis results in acute sensitivity to combined light and drought stress. DOI: 10.1104/pp.107.115121 ; PMID: 18424626
- Comprehensive flavonol profiling and transcriptome coexpression analysis leading to decoding gene-metabolite correlations in Arabidopsis. DOI: 10.1105/tpc.108.058040 ; PMID: 18757557
- Accumulation of flavonoids in an ntra ntrb mutant leads to tolerance to UV-C. DOI: 10.1093/mp/ssn065 ; PMID: 19825611
- Metabolic profiling and cytological analysis of proanthocyanidins in immature seeds of Arabidopsis thaliana flavonoid accumulation mutants. DOI: 10.1111/j.1365-313X.2010.04174.x ; PMID: 20180920
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- The Arabidopsis tt19-4 mutant differentially accumulates proanthocyanidin and anthocyanin through a 3' amino acid substitution in glutathione S-transferase. DOI: 10.1111/j.1365-3040.2010.02249.x ; PMID: 21054438
- Complexity and robustness of the flavonoid transcriptional regulatory network revealed by comprehensive analyses of MYB-bHLH-WDR complexes and their targets in Arabidopsis seed. DOI: 10.1111/nph.12620 ; PMID: 24299194
- Anthocyanin Vacuolar Inclusions Form by a Microautophagy Mechanism. DOI: 10.1105/tpc.15.00589 ; PMID: 26342015
- Root avoidance of toxic metals requires the GeBP-LIKE 4 transcription factor in Arabidopsis thaliana. DOI: 10.1111/nph.14242 ; PMID: 27768815
- Functional characterization of a heterologously expressed Brassica napus WRKY41-1 transcription factor in regulating anthocyanin biosynthesis in Arabidopsis thaliana. DOI: 10.1016/j.plantsci.2017.12.010 ; PMID: 29362083
- Synergy between the anthocyanin and RDR6/SGS3/DCL4 siRNA pathways expose hidden features of Arabidopsis carbon metabolism. DOI: 10.1038/s41467-020-16289-3 ; PMID: 32415123
- ARF2 positively regulates flavonols and proanthocyanidins biosynthesis in Arabidopsis thaliana. DOI: 10.1007/s00425-022-03936-w ; PMID: 35857143
- MAX1, a regulator of the flavonoid pathway, controls vegetative axillary bud outgrowth in Arabidopsis. DOI: 10.1073/pnas.0509463102 ; PMID: 16387852
- Identification of genes expressed in vascular tissues using NPA-induced vascular overgrowth in Arabidopsis. DOI: 10.1093/pcp/pcn023 ; PMID: 18296723
Gene Resources
Sequences
cDNA Sequence
- >AT5G17220.1
ACATCTACTCTCATTTCTTCTCATTTATAAACCAGTTTGATAGACAAGATATTAATAAGTGCATATAGTAAAATCTTTCTTATTCGTAACAAAGTTATTGTAAACTTATAGAATGGTTGTGAAACTATATGGACAGGTAACAGCAGCTTGTCCACAAAGAGTCTTGCTTTGTTTTCTCGAGAAAGGAATTGAATTTGAGATTATTCATATCGATCTTGATACATTTGAGCAAAAAAAACCAGAACATCTTCTTCGTCAGCCATTTGGTCAAGTTCCAGCCATAGAAGATGGAGATTTCAAGCTTTTTGAATCACGAGCCATCGCGAGATACTACGCTACCAAGTTCGCGGACCAAGGCACGAACCTTTTGGGCAAGTCTCTAGAGCACCGAGCCATCGTGGACCAGTGGGCTGACGTGGAGACCTATTACTTCAACGTTCTGGCCCAACCCCTCGTGATTAACCTAATCATCAAGCCTAGGTTAGGCGAGAAATGTGACGTCGTTTTGGTCGAGGATCTCAAAGTGAAGCTAGGAGTGGTCTTGGACATATACAATAACCGGCTTTCTTCGAACCGGTTTTTGGCTGGTGAAGAATTCACTATGGCTGATTTGACGCACATGCCGGCGATGGGGTACTTGATGAGTATAACCGATATAAACCAGATGGTTAAGGCTCGGGGTAGTTTTAACCGGTGGTGGGAAGAGATTTCGGATAGACCGTCTTGGAAGAAGCTTATGGTGCTGGCTGGTCACTGAATTAGCTCCAATTTATGATGATCTGAAGAACCAAATAAGCTTTATAGTTTCTGTTTTATGTTTGTGTTGTTTTGTACGTTTCAGTAATAAATTCAATATACTTTTAAGATTCATGTCAATGCTAAGACCATAGTTCTCTATTCTTAAGTTTTTACTCTATTTTTGAGTGAGATATAAAATGGGGTTAAAATAGAAGTGGAGTTTTTACATAGTATACAAGGTTACTCACTTGTACTATTATTCGAATATAAGAAGAACTTCTTTCTGTATGTATATCACAAGATTATTTCATCAACCAAAAATTGTATATCCCCTCATTAGGCCAAGAGAACTATAACT
CDS Sequence
Protein Sequence