Gene Details:
- Gene ID: AT5G16710
- Gene Symbol: DHAR3
- Gene Name: dehydroascorbate reductase 1
- Description: dehydroascorbate reductase 1;(source:Araport11)
- TAIR Accession: locus:2149015
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0140547 — acts upstream of or within — acquisition of seed longevity
- GO:0019852 — acts upstream of or within — L-ascorbic acid metabolic process
- GO:0033355 — involved in — ascorbate glutathione cycle
- GO:0004364 — enables — glutathione transferase activity
- GO:0009941 — located in — chloroplast envelope
- GO:0009507 — located in — chloroplast
- GO:0009570 — located in — chloroplast stroma
- GO:0045174 — enables — glutathione dehydrogenase (ascorbate) activity
- GO:0098869 — involved in — cellular oxidant detoxification
- GO:0098869 — acts upstream of or within — cellular oxidant detoxification
- GO:0009536 — located in — plastid
Germplasm Phenotype:
- dhar123 — Triple mutant dhar123 resembles dhar1-4. Similar seed longevity decrease.
Function-related keywords:
Literature:
- Functional divergence in the glutathione transferase superfamily in plants. Identification of two classes with putative functions in redox homeostasis in Arabidopsis thaliana. DOI: 10.1074/jbc.M202919200 ; PMID: 12077129
- Molecular definition of the ascorbate-glutathione cycle in Arabidopsis mitochondria reveals dual targeting of antioxidant defenses in plants. DOI: 10.1074/jbc.M307525200 ; PMID: 12954611
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Proteomic analysis of glutathione S -transferases of Arabidopsis thaliana reveals differential salicylic acid-induced expression of the plant-specific phi and tau classes. DOI: 10.1023/B:PLAN.0000028786.57439.b3 ; PMID: 15159623
- Evidence for a direct link between glutathione biosynthesis and stress defense gene expression in Arabidopsis. DOI: 10.1105/tpc.104.022608 ; PMID: 15308753
- New targets of Arabidopsis thioredoxins revealed by proteomic analysis. DOI: 10.1002/pmic.200400805 ; PMID: 15352244
- Cytosolic dehydroascorbate reductase is important for ozone tolerance in Arabidopsis thaliana. DOI: 10.1093/pcp/pci246 ; PMID: 16361320
- Proteomic analysis and extensive protein identification from dry, germinating Arabidopsis seeds and young seedlings. DOI: 10.5483/bmbrep.2005.38.6.650 ; PMID: 16336779
- Islands of co-expressed neighbouring genes in Arabidopsis thaliana suggest higher-order chromosome domains. DOI: 10.1111/j.1365-313X.2005.02619.x ; PMID: 16412082
- Comparative proteomic approaches for the isolation of proteins interacting with thioredoxin. DOI: 10.1002/pmic.200600443 ; PMID: 17163439
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins. DOI: 10.1371/journal.pone.0073291 ; PMID: 24023856
- Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying and up-regulation. DOI: 10.1093/jxb/ert227 ; PMID: 24064926
- Arabidopsis dehydroascorbate reductase 1 and 2 modulate redox states of ascorbate-glutathione cycle in the cytosol in response to photooxidative stress. DOI: 10.1080/09168451.2016.1256759 ; PMID: 27852156
- Cytosolic and Chloroplastic DHARs Cooperate in Oxidative Stress-Driven Activation of the Salicylic Acid Pathway. DOI: 10.1104/pp.17.00317 ; PMID: 28381499
- Dehydroascorbate Reductases and Glutathione Set a Threshold for High-Light-Induced Ascorbate Accumulation. DOI: 10.1104/pp.19.01556 ; PMID: 32205453
- Identification of novel seed longevity genes related to oxidative stress and seed coat by genome-wide association studies and reverse genetics. DOI: 10.1111/pce.13822 ; PMID: 32519347
- Elevating Ascorbate in Arabidopsis Stimulates the Production of Abscisic Acid, Phaseic Acid, and to a Lesser Extent Auxin (IAA) and Jasmonates, Resulting in Increased Expression of DHAR1 and Multiple Transcription Factors Associated with Abiotic Stress Tolerance. DOI: 10.3390/ijms22136743 ; PMID: 34201662
- H(2)O(2) response gene 1/2 are novel sensors or responders of H(2)O(2) and involve in maintaining embryonic root meristem activity in Arabidopsis thaliana. DOI: 10.1016/j.plantsci.2021.110981 ; PMID: 34315597
- Overexpression mutants reveal a role for a chloroplast MPD protein in regulation of reactive oxygen species during chilling in Arabidopsis. DOI: 10.1093/jxb/erac029 ; PMID: 35084440
- Chloroplast dehydroascorbate reductase and glutathione cooperatively determine the capacity for ascorbate accumulation under photooxidative stress conditions. DOI: 10.1111/tpj.16117 ; PMID: 36694959
- Proteomic study of the Arabidopsis thaliana chloroplastic envelope membrane utilizing alternatives to traditional two-dimensional electrophoresis. DOI: 10.1021/pr034025j ; PMID: 12938931
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- Stress-induced protein S-glutathionylation in Arabidopsis. DOI: 10.1104/pp.104.058917 ; PMID: 16055689
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequences:
cDNA Sequence
- >AT5G16710.1
ATCTGAGTCATGAGCCAGTTGACTAGTTGGAAATTAAACCACTGCGAAAAATATGATAAGCCTTAGGTTTCAACCAAGCACCACCGCCGGTGTTTTATCGGCGTCAGTGAGCCGCGCCGGTTTTATCAAGCGGTGCGGTTCGACTAAACCGGGAAGGGTTGGCCGGTTTGTTACAATGGCGACGGCGGCGAGTCCTCTTGAAATCTGCGTTAAAGCTTCTATCACCACTCCCAACAAGCTCGGAGACTGCCCTTTTTGCCAAAAGGTGTTACTGACAATGGAGGAGAAGAATGTTCCTTATGACATGAAAATGGTGGATTTGAGTAACAAACCAGAATGGTTCTTGAAGATTAGTCCAGAAGGTAAAGTCCCAGTTGTGAAGTTTGATGAGAAATGGGTTCCGGATTCAGATGTTATAACACAGGCTTTAGAAGAGAAGTATCCTGAGCCTCCTCTTGCTACCCCACCTGAAAAGGCTTCAGTTGGATCGAAGATCTTTTCCACATTTGTCGGTTTTCTGAAGAGCAAAGATTCAGGAGATGGAACTGAGCAAGTTTTGTTGGATGAGCTTACTACATTCAACGATTATATCAAGGACAATGGCCCTTTCATAAATGGAGAGAAGATCTCGGCAGCAGATTTGTCCTTGGCACCAAAGTTATACCACATGAAGATTGCATTGGGACATTACAAGAACTGGTCTGTTCCAGATTCACTTCCTTTCGTCAAATCCTACATGGAGAATGTTTTCTCGAGGGAATCATTCACGAACACACGGGCGGAAACAGAGGATGTAATTGCTGGTTGGAGACCAAAGGTTATGGGTTAAGAGATTTTGATGTTGACCTCAAGCTTCCTTGTCTTCTACTAAATGTAAAAAACATAATAATCAAATCTTCTTCAACTGTTACCAATGATATATACCTTGAATCCTTGATTGCTTATATGATGAAAACTATATTGTGTCATAGTGGGGAAGCTTGCATATAAGTTTTAATGTACCGACCAATCACTACTAAAATTTTGAACCATCTGCAAATTATTTACCGTAAGCTACAGAGCAATTAGACGACCATTGAAAGAACAAT
CDS Sequence
Protein Sequence