Information report for AT5G15960
Gene Details
|
|
Functional Descriptions
Functional Keywords
Literature and News
- The sfr6 mutation in Arabidopsis suppresses low-temperature induction of genes dependent on the CRT/DRE sequence motif. DOI: 10.1105/tpc.11.5.875 ; PMID: 10330472
- HOS1, a genetic locus involved in cold-responsive gene expression in arabidopsis. DOI: 10.1105/tpc.10.7.1151 ; PMID: 9668134
- Purification and properties of Arabidopsis thaliana COR (cold-regulated) gene polypeptides COR15am and COR6.6 expressed in Escherichia coli. DOI: 10.1104/pp.111.1.293 ; PMID: 8685269
- cDNA sequence analysis and expression of two cold-regulated genes of Arabidopsis thaliana. DOI: 10.1007/BF00018452 ; PMID: 1731964
- Regulation of osmotic stress-responsive gene expression by the LOS6/ABA1 locus in Arabidopsis. DOI: 10.1074/jbc.M109275200 ; PMID: 11779861
- A mitochondrial complex I defect impairs cold-regulated nuclear gene expression. DOI: 10.1105/tpc.010433 ; PMID: 12084824
- Identification of Arabidopsis genes regulated by high light-stress using cDNA microarray. DOI: 10.1562/0031-8655(2003)077<0226:ioagrb>2.0.co;2 ; PMID: 12785063
- Stress memory in plants: a negative regulation of stomatal response and transient induction of rd22 gene to light in abscisic acid-entrained Arabidopsis plants. DOI: 10.1046/j.1365-313x.2003.01872.x ; PMID: 14535888
- The cold-induced early activation of phospholipase C and D pathways determines the response of two distinct clusters of genes in Arabidopsis cell suspensions. DOI: 10.1104/pp.105.068171 ; PMID: 16258011
- Involvement of GIGANTEA gene in the regulation of the cold stress response in Arabidopsis. DOI: 10.1007/s00299-005-0061-x ; PMID: 16231185
- A novel drought-inducible gene, ATAF1, encodes a NAC family protein that negatively regulates the expression of stress-responsive genes in Arabidopsis. DOI: 10.1007/s11103-006-9089-8 ; PMID: 17031511
- Arabidopsis hot2 encodes an endochitinase-like protein that is essential for tolerance to heat, salt and drought stresses. DOI: 10.1111/j.1365-313X.2006.02950.x ; PMID: 17156413
- Light-quality regulation of freezing tolerance in Arabidopsis thaliana. DOI: 10.1038/ng.2007.3 ; PMID: 17965713
- The relationship of drought-related gene expression in Arabidopsis thaliana to hormonal and environmental factors. DOI: 10.1093/jxb/ern155 ; PMID: 18552355
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Control of flowering time and cold response by a NAC-domain protein in Arabidopsis. DOI: 10.1371/journal.pone.0000642 ; PMID: 17653269
- HHP1, a novel signalling component in the cross-talk between the cold and osmotic signalling pathways in Arabidopsis. DOI: 10.1093/jxb/erq162 ; PMID: 20566565
- A calcium/calmodulin-regulated member of the receptor-like kinase family confers cold tolerance in plants. DOI: 10.1074/jbc.M109.035659 ; PMID: 20026608
- ICE1 Ser403 is necessary for protein stabilization and regulation of cold signaling and tolerance. DOI: 10.1111/j.1365-313X.2011.04589.x ; PMID: 21447070
- The plant cuticle is required for osmotic stress regulation of abscisic acid biosynthesis and osmotic stress tolerance in Arabidopsis. DOI: 10.1105/tpc.110.081943 ; PMID: 21610183
- AtPP2CG1, a protein phosphatase 2C, positively regulates salt tolerance of Arabidopsis in abscisic acid-dependent manner. DOI: 10.1016/j.bbrc.2012.05.064 ; PMID: 22627139
- Homologous HAP5 subunit from Picea wilsonii improved tolerance to salt and decreased sensitivity to ABA in transformed Arabidopsis. DOI: 10.1007/s00425-013-1894-0 ; PMID: 23703145
- Overexpression of Late Embryogenesis Abundant 14 enhances Arabidopsis salt stress tolerance. DOI: 10.1016/j.bbrc.2014.10.136 ; PMID: 25450686
- AtUGT76C2, an Arabidopsis cytokinin glycosyltransferase is involved in drought stress adaptation. DOI: 10.1016/j.plantsci.2015.04.002 ; PMID: 26025529
- Melatonin induces the transcripts of CBF/DREB1s and their involvement in both abiotic and biotic stresses in Arabidopsis. DOI: 10.1111/jpi.12262 ; PMID: 26182834
- The CCCH zinc finger protein gene AtZFP1 improves salt resistance in Arabidopsis thaliana. DOI: 10.1007/s11103-014-0226-5 ; PMID: 25074582
- Salt hypersensitive mutant 9, a nucleolar APUM23 protein, is essential for salt sensitivity in association with the ABA signaling pathway in Arabidopsis. DOI: 10.1186/s12870-018-1255-z ; PMID: 29490615
- Arabidopsis PCaP2 Plays an Important Role in Chilling Tolerance and ABA Response and SnRK2-Mediated Transcriptional Regulatory Network. DOI: 10.3389/fpls.2018.00215 ; PMID: 29568301
- Arabidopsis PCaP2 Functions as a Linker Between ABA and SA Signals in Plant Water Deficit Tolerance. DOI: 10.3389/fpls.2018.00578 ; PMID: 29868051
- Corrigendum: Arabidopsis PCaP2 Functions as a Linker Between ABA and SA Signals in Plant Water Deficit Tolerance. DOI: 10.3389/fpls.2018.01062 ; PMID: 30083177
- AtCaM4 interacts with a Sec14-like protein, PATL1, to regulate freezing tolerance in Arabidopsis in a CBF-independent manner. DOI: 10.1093/jxb/ery278 ; PMID: 30124909
- Expression Pattern and Function Analysis of AtPPRT1, a Novel Negative Regulator in ABA and Drought Stress Responses in Arabidopsis. DOI: 10.3390/ijms20020394 ; PMID: 30658512
- GmWRKY16 Enhances Drought and Salt Tolerance Through an ABA-Mediated Pathway in Arabidopsis thaliana. DOI: 10.3389/fpls.2018.01979 ; PMID: 30740122
- The Arabidopsis UDP-glycosyltransferase75B1, conjugates abscisic acid and affects plant response to abiotic stresses. DOI: 10.1007/s11103-019-00953-4 ; PMID: 31894456
- Phytochrome-interacting factors regulate seedling growth through ABA signaling. DOI: 10.1016/j.bbrc.2020.04.011 ; PMID: 32307082
- A C-terminal fragment of Arabidopsis OXIDATIVE STRESS 2 can play a positive role in salt tolerance. DOI: 10.1016/j.bbrc.2021.03.127 ; PMID: 33836344
- The relationship of drought-related gene expression in Arabidopsis thaliana to hormonal and environmental factors. DOI: 10.1093/jxb/ern155 ; PMID: 18552355
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A178UK02
- EMBL: CACRSJ010000110, CACSHJ010000096, LR881470
- AlphaFoldDB: A0A178UK02
- EnsemblPlants: AT5G15960.1
- Gramene: AT5G15960.1
- KEGG: ath:AT5G15960
- Orthologous matrix: VSDPYTY
- ExpressionAtlas: AT5G15960
Sequences
cDNA Sequence
- >AT5G15960.1
GGATCATACTCTCACACAGAAAGAGTCACATTATTATATCCTCTAAAAAACCAAACTAAAACGACACGTGAAGTCTTGATCAGCCGATAAATAGCTACCGACATAAGGCAAAACTGATCGTACCATCAAATGTAATCCACGTGGTTTTAGATTACTCGTGGCACCACACTCCCTTTAGCCTATAAATATAAACCATTAAGCCCACATCTCTTCTCATCATCACTAACCAAAACACACTTCAAAAACGATTTTACAAGAAATAAATATCTGAAAAAATGTCAGAGACCAACAAGAATGCCTTCCAAGCCGGTCAGACCGCTGGCAAAGCTGAGGAGAAGAGCAATGTTCTGCTGGACAAGGCCAAGGATGCTGCAGCTGGTGCTGGAGCTGGAGCACAACAGGCGGGAAAGAGTGTATCGGATGCGGCAGCGGGAGGTGTTAACTTCGTGAAGGACAAGACCGGCCTGAACAAGTAGCGATTCGGGTCAAATTTGGGAGTTATAATTTCCCTTTTCTAATTAACTGTTGGGATTTTCAAATAAACGATCTTTGATCAAGAATTGCATTATATATATATAAATATATTGCAAAATTATTAGACGAGCCAAACTTATATTCAAATAATGTTTTATCTATTTTAAAAAATATTCTTTATGCGAAAGATCAAACTCCCCAAACGATGTTAAATGGATCACGATACATAAGTCGATCCGAATTGTTGAAGTTTTCTAAAAATGCAGTCCTTATAATTGTATTAAACACACTAAATCTTCCAAACACACAGAAGGAAATCACTATAATTGTTATAATGGATATAGGAGAACTAACT
CDS Sequence
Protein Sequence