Gene Details:
- Gene ID: AT5G15200
- Gene Symbol: uS4z
- Gene Name: Ribosomal Protein uS4z
- Description: Ribosomal protein S4;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- The Arabidopsis root transcriptome by serial analysis of gene expression. Gene identification using the genome sequence. DOI: 10.1104/pp.103.030536 ; PMID: 14730065
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- The maize root transcriptome by serial analysis of gene expression. DOI: 10.1104/pp.104.057638 ; PMID: 15965024
- Immunopurification of polyribosomal complexes of Arabidopsis for global analysis of gene expression. DOI: 10.1104/pp.105.059477 ; PMID: 15955926
- Identification of plant promoter constituents by analysis of local distribution of short sequences. DOI: 10.1186/1471-2164-8-67 ; PMID: 17346352
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night. DOI: 10.1371/journal.pone.0029307 ; PMID: 22195043
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. DOI: 10.1091/mbc.e04-09-0791 ; PMID: 15496452
- Proteomic characterization of evolutionarily conserved and variable proteins of Arabidopsis cytosolic ribosomes. DOI: 10.1104/pp.104.053637 ; PMID: 15734919
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Immunopurification of polyribosomal complexes of Arabidopsis for global analysis of gene expression. DOI: 10.1104/pp.105.059477 ; PMID: 15955926
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Immunopurification of polyribosomal complexes of Arabidopsis for global analysis of gene expression. DOI: 10.1104/pp.105.059477 ; PMID: 15955926
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
Sequences:
cDNA Sequence
- >AT5G15200.2
CATTCGTCTCTTTCGTTCCTCTCTGCGTGCCCTAGTTATTCAGATCGCCGAATTTGCAGTAAGGAGACGAAAATATGGTGCACGTTTGCTACTACCGCAACTATGGAAAGACCTTCAAGGGACCACGTCGTCCTTACGAGAAGGAGCGTCTTGATTCTGAATTGAAGCTGGTTGGTGAGTATGGTCTGCGTAACAAGCGTGAGCTCTGGAGAGTGCAGTACTCTCTTAGCCGTATCCGTAATGCTGCTAGAGATCTTTTGACTCTTGATGAGAAGAGTCCAAGAAGGATCTTTGAAGGTGAGGCTTTGCTCCGTAGGATGAACCGTTACGGGCTTCTTGATGAGAGCCAGAACAAGCTCGATTACGTCTTGGCTTTGACTGTTGAGAACTTTCTTGAGCGTCGTCTTCAGACTATTGTGTTCAAGTCTGGTATGGCTAAGTCTATCCATCACTCTCGTGTCCTCATCAGGCAGAGGCATATCAGGTATTGCATCTCTTCGATTTATTTGTGCTTGTGTATGAATTATCTTTGTTATATCAATTGATAGGATCTGAAATGAAATTAACATTTTCTCTGTTTCCATTTCATGATTATCTTTGAATGATTCGGCTTTGTGTTACACTTCTTTAAACACTGTCTCTTTGGTCTAACAGATTGTAGTCTTTCATGAGTTTGTACTGTCTTTTGGTTTGATCTTTCTTCAAACGTTTTATTGGTTGCTCTTAAGTTCACGCAAGTCTTGATAACTTGTGCCTCTTGAGTGGCTTAATATGAAGTGTGTTTTGATATGATCTTAAAAATTGGGTACTCATATTTGTTTCGGGTGTTGTTGTAGGGTTGGAAAGCAATTGGTGAA - >AT5G15200.1
CATTCGTCTCTTTCGTTCCTCTCTGCGTGCCCTAGTTATTCAGATCGCCGAATTTGCAGTAAGGAGACGAAAATATGGTGCACGTTTGCTACTACCGCAACTATGGAAAGACCTTCAAGGGACCACGTCGTCCTTACGAGAAGGAGCGTCTTGATTCTGAATTGAAGCTGGTTGGTGAGTATGGTCTGCGTAACAAGCGTGAGCTCTGGAGAGTGCAGTACTCTCTTAGCCGTATCCGTAATGCTGCTAGAGATCTTTTGACTCTTGATGAGAAGAGTCCAAGAAGGATCTTTGAAGGTGAGGCTTTGCTCCGTAGGATGAACCGTTACGGGCTTCTTGATGAGAGCCAGAACAAGCTCGATTACGTCTTGGCTTTGACTGTTGAGAACTTTCTTGAGCGTCGTCTTCAGACTATTGTGTTCAAGTCTGGTATGGCTAAGTCTATCCATCACTCTCGTGTCCTCATCAGGCAGAGGCATATCAGGTATTGCATCTCTTCGATTTATTTGTGCTTGTGTATGAATTATCTTTGTTATATCAATTGATAGGATCTGAAATGAAATTAACATTTTCTCTGTTTCCATTTCATGATTATCTTTGAATGATTCGGCTTTGTGTTACACTTCTTTAAACACTGTCTCTTTGGTCTAACAGATTGTAGTCTTTCATGAGTTTGTACTGTCTTTTGGTTTGATCTTTCTTCAAACGTTTTATTGGTTGCTCTTAAGTTCACGCAAGTCTTGATAACTTGTGCCTCTTGAGTGGCTTAATATGAAGTGTGTTTTGATATGATCTTAAAAATTGGGTACTCATATTTGTTTCGGGTGTTGTTGTAGGGTTGGAAAGCAATTGGTGAA
CDS Sequence
Protein Sequence