Information report for AT5G15150
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009001 — fruit — frucht (exact, German), fruto (exact, Spanish), 果実 (exact, Japanese), coenocarp (narrow), syncarp (narrow), aggregate fruit (broad), compound fruit (broad), dehiscent fruit (broad), diaspore (broad), indehiscent fruit (broad), multiple fruit (broad), propagule (broad)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
- PO:0000258 — root cortex — cortex de la raíz (Spanish, exact), portion of root cortex tissue (exact), 根皮層 (Japanese, exact)
- PO:0025257 — primary root elongation zone — zona de elongación de la raíz primaria (Spanish, exact), 一次根伸長帯（層） (Japanese, exact)
Functional Keywords
- root , fruit , root , flower , stem , root cortex , primary root elongation zone
Literature and News
- Expression patterns of novel genes encoding homeodomain leucine-zipper proteins in Arabidopsis thaliana. DOI: 10.1007/BF00039527 ; PMID: 7948864
- Structure of homeobox-leucine zipper genes suggests a model for the evolution of gene families. DOI: 10.1073/pnas.91.18.8393 ; PMID: 7915839
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- DNA-binding and dimerization preferences of Arabidopsis homeodomain-leucine zipper transcription factors in vitro. DOI: 10.1023/a:1006423324025 ; PMID: 11247607
- The FHY3 and FAR1 genes encode transposase-related proteins involved in regulation of gene expression by the phytochrome A-signaling pathway. DOI: 10.1046/j.1365-313x.2003.01741.x ; PMID: 12753585
- Dissection of floral induction pathways using global expression analysis. DOI: 10.1242/dev.00842 ; PMID: 14573523
- Transcriptional regulation of secondary growth in Arabidopsis thaliana. DOI: 10.1093/jxb/erg304 ; PMID: 14585825
- Homeodomain leucine zipper class I genes in Arabidopsis. Expression patterns and phylogenetic relationships. DOI: 10.1104/pp.105.063461 ; PMID: 16055682
- The Arabidopsis zinc finger-homeodomain genes encode proteins with unique biochemical properties that are coordinately expressed during floral development. DOI: 10.1104/pp.105.070565 ; PMID: 16428600
- Identification of primary target genes of phytochrome signaling. Early transcriptional control during shade avoidance responses in Arabidopsis. DOI: 10.1104/pp.105.076331 ; PMID: 16565297
- The LEAFY target LMI1 is a meristem identity regulator and acts together with LEAFY to regulate expression of CAULIFLOWER. DOI: 10.1242/dev.02331 ; PMID: 16554366
- Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots. DOI: 10.1073/pnas.0510607103 ; PMID: 16581911
- Quantification of transcription factor expression from Arabidopsis images. DOI: 10.1093/bioinformatics/btl228 ; PMID: 16873489
- Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seed germination and floral development in Arabidopsis. DOI: 10.1104/pp.106.082289 ; PMID: 16920880
- Arabidopsis homeobox-leucine zipper transcription factor BRASSINOSTEROID-RELATED HOMEOBOX 3 regulates leaf greenness by suppressing BR signaling. DOI: 10.5511/plantbiotechnology.22.0128a ; PMID: 35937537
- Brassinosteroid gene regulatory networks at cellular resolution in the Arabidopsis root. DOI: 10.1126/science.adf4721 ; PMID: 36996230
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots. DOI: 10.1073/pnas.0510607103 ; PMID: 16581911
Gene Resources
- UniProt: B5RID5
- EMBL: BT044059
- AlphaFoldDB: B5RID5
- EnsemblPlants: AT5G15150.1
- Gramene: AT5G15150.1
- KEGG: ath:AT5G15150
- Orthologous matrix: FHNIDEQ
- ExpressionAtlas: AT5G15150
Sequences
cDNA Sequence
- >AT5G15150.1
CAGATATGTAAATGAAGTGGAAAATGTATGTACGTATCCATAATCCATGTGCTATTTAATTTCAATTTTAATTTCCCAAGTGTCCTATACAAATTGAATCAAAAGAAAAATCAGCATATGCCCTAAAAGCTTAAATGGTATAAAGGGTGGGTCCTATACAAACCTCCCATGAACTGATCTCTTCCTTCTTCTCCTTCTTCTTCTCTTCTCACTAATTTTCCTTCAGAAAACTTCAACGATCTTGTGATATTGATATCTAAACAAGTTCTTGATCTAAGCTACGAAAGTTGATCTGCTCAGAATTCATAATAAGAGTTGATCATTTGTGGGCTTTGAGGGTGTGTATACATACATATTAATTATATATATGTATATGTATGAGGAGGAAAGGAACAATATCAATAATAATCAAGAAGGACTGAGATTGGAGATGGCCTTTCCTCAACATGGCTTCATGTTTCAGCAACTCCATGAAGACAATGCTCATCACTTACCTTCCCCAACCTCTCTCCCCTCTTGTCCTCCTCATCTCTTCTATGGAGGAGGAGGAAACTACATGATGAACAGATCAATGTCGTTCACGGGAGTATCAGATCATCATCATCTAACTCAAAAAAGCCCGACAACAACGAACAACATGAATGATCAAGACCAGGTAGGCGAGGAAGACAACCTATCAGACGATGGGTCACATATGATGTTAGGAGAGAAGAAGAAGAGGCTGAATTTAGAGCAAGTTAGGGCATTAGAGAAGAGCTTCGAGCTAGGGAACAAGCTGGAGCCAGAGAGGAAGATGCAGCTTGCTAAGGCTTTAGGATTGCAGCCTAGGCAGATTGCAATATGGTTTCAGAACAGGAGAGCTAGGTGGAAGACAAAGCAGCTCGAGAGAGACTATGATTCTCTCAAAAAACAGTTCGATGTTTTGAAATCGGACAATGATTCTCTTCTTGCCCACAACAAGAAACTACATGCTGAGTTAGTGGCATTGAAGAAACACGACCGTAAAGAATCAGCAAAGATCAAGAGAGAATTCGCAGAAGCTTCATGGAGCAACAATGGAAGCACAGAAAATAATCATAACAATAATAGTTCAGACGCTAATCATGTGAGCATGATCAAAGATCTTTTCCCTTCTTCGATCCGATCCGCGACCGCGACCACGACCTCTACCCATATTGATCATCAGATTGTTCAAGATCAAGATCAAGGGTTTTGCAATATGTTCAATGGTATTGATGAAACGACGTCGGCTAGTTATTGGGCATGGCCTGACCAGCAGCAACAACATCACAATCATCATCAGTTCAATTGATCATATTGTCTAAGAACAACATCATACTCATCTTGATATCATTATTATCATCAAAAGAAAATTTCGTAGATTTTTTTAATAAGTATTTTCAAATTATTTGGCACGTTTAAAATTAATTAAATTGGGTTATTATGTTTTTTTTTTCTCTCCTTTGGGTTTGTAGAGAATTGGTGTATAGGGGATACTCAACAAATTTGTAGTATGATATTTTCTTGTTACTTGTATTGAATGAATAAATTTTTCTTTCATATC
CDS Sequence
Protein Sequence