AT5G14620

Gene Details

Gene ID: AT5G14620
Gene Symbol: DMT7, DRM2
Gene Name: domains rearranged methyltransferase 2
Description: domains rearranged methyltransferase 2;(source:Araport11)
TAIR Accession: locus:2222627
Genome: Araport11_genome_release
Species: Arabidopsis thaliana

Functional Descriptions

PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
PO:0009049 — inflorescence — inflorescencia (Spanish, exact), 花序 (Japanese, exact), Triticeae spike (narrow)
PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)

GO:0006306 — acts upstream of or within — DNA methylation
GO:0050832 — acts upstream of or within — defense response to fungus
GO:0005654 — located in — nucleoplasm
GO:0006306 — involved in — DNA methylation
GO:0009008 — enables — DNA-methyltransferase activity
GO:0006346 — involved in — DNA methylation-dependent heterochromatin formation
GO:0005515 — enables — protein binding
GO:0005634 — located in — nucleus
GO:0005634 — is active in — nucleus
GO:0003886 — enables — DNA (cytosine-5-)-methyltransferase activity
GO:0008170 — enables — N-methyltransferase activity

CS16383 — No visible phenotype.
CS16384 — Plants show developmental phenotypes, including reduced plant size and curled leaves.
CS16386 — No visible phenotype.
CS16387 — Unusual development patterns and plant structure; phenotype develops after inbreeding.
CS16388 — Reduced plant size; curled leaves.
CS6366 — Wild type morphology; double mutant that retains preexixting CpG methylation at the endogenous FWA locus but lacks de novo CpG methylation normaly associated with FWA transgene silencing; blocks de novo CpNpG and asymmetric methylation and gene silencing of the endogenous Superman (SUP) gene, which is normally triggered by an inverted SUP repeat, doesnt show reactivation of previously established SUP epigenetic silenced alleles 12121623
AT5G14620 CS69842 Reactivation of GFP fluorescence in root meristems of seedlings. AT5G14620 CS69843 Reactivation of GFP fluorescence in root meristems of seedlings. AT5G14620 CS69844 Reactivation of GFP fluorescence in root meristems of seedlings. AT5G14620 CS72761 Quintuple homozygous plants exhibit extreme growth retardation and small size, display a suite of severe developmental defects, and do not undergo floral transition. AT5G14620 CS9605 impaired gene silencing, reduced de novo methylation AT5G14660 def2 Reduced seed weight AT5G14720 SALK_065417 significantly shorter hypocotyl at 28 °C 33990595
AT5G14720 SALK_086087 significantly shorter hypocotyl at 28 °C 33990595
AT5G14750 CS6349 Altered epidermal cell determination in the root and hypocotyl (but not leaf); extra root hair cells are produced in the root (hairy root); abnormally distributed stomata are produced in the hypocotyl. AT5G14750 CS67773 Excessive root hair production. GFP is expressed in all stages of differentiating root epidermal cells, in both hair (H) and non-hair (N) cell types, although preferentially in the N cells. AT5G14800 SALK_067384 Reduced activity of PFK in 7-day-old seedlings. Reduced root length. 33800095
AT5G14870 cngc18-1 Pollen tubes show severe growth defect. Tubes are kinky, short, and often thin. Tubes grow only a short distance with nondirectional growth, often terminating prematurely with a bursting event. 17726111
AT5G14950 SALK_052443 Defective in the formation of hybrid and complex N-glycans. Viable and fertile and do not show any obvious phenotype under standard growth conditions. 11432912
AT5G15070 CS2109994 seedling lethal AT5G15070 CS2110007 seedling lethal AT5G15070 CS2110008 smaller rosette AT5G15120 SALK_108381C “Seedlings screened in bulk via high throughput methods for responses to various stressors. Results are in comparison to Col-0.heat:decreased,cold:decreased,oxidative stress:decreased,osmotic stress:no change,salt stress:no change,ABA:no change,hypoxia:ND.” 23517122
AT5G15160 bnq1 rnai; bnq2 rnai; bnq3 Same as bnq3 single mutants: sepals and carpels are pale yellow or white,while the inflorescence stems and siliques are purple 20305124
AT5G15160 bnq2 rnai WT phenotype 20305124
AT5G15170 SALK_119060C No obvious morphological defect. No increased sensitivity to CPT, a DNA protein crosslink inducing compound. 30760561
AT5G15190 SALK_079419C “Seedlings screened in bulk via high throughput methods for responses to various stressors. Results are in comparison to Col-0.heat:no change,cold:no change,oxidative stress:no change,osmotic stress:no change,salt stress:decreased,ABA:no change,hypoxia:ND.” 23517122
AT5G15250 SALK_012429 No visible change in plant growth, development or pigmentation. 16157880
AT5G15250 ftsh6 no visible difference in leaf morphology and variegation when grown under normal light and temperature conditions compared to wild-type. 14630971
AT5G15380 CS6366 Wild type morphology; double mutant that retains preexixting CpG methylation at the endogenous FWA locus but lacks de novo CpG methylation normaly associated with FWA transgene silencing; blocks de novo CpNpG and asymmetric methylation and gene silencing of the endogenous Superman (SUP) gene, which is normally triggered by an inverted SUP repeat, doesnt show reactivation of previously established SUP epigenetic silenced alleles

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>AT5G14620.1
GTTTCCTCCTCCAGTAAACTGACGACGATACAAGCTCTCTCACCAACGGCGACAGTATCTTTGCCGGCGGCGGGAGCGCTTCTGCTTAATCTGTAGCTCAAACTAAAAATTCTCTGGGTATTACTCATGGTGATTTGGAATAACGATGATGATGATTTTTTGGAGATTGATAACTTTCAATCTTCTCCACGGTCATCTCCAATACATGCAATGCAGTGTAGGGTCGAAAATCTAGCTGGTGTAGCCGTGACAACTAGTTCTTTGAGCTCTCCTACTGAGACAACTGATTTAGTTCAGATGGGCTTCTCAGACGAGGTTTTTGCTACATTGTTTGACATGGGATTTCCTGTTGAGATGATTTCTAGAGCGATCAAGGAAACTGGACCAAATGTAGAAACTTCGGTTATAATTGATACTATCTCCAAATACTCAAGCGACTGTGAAGCTGGTTCTTCCAAGTCCAAGGCTATTGATCATTTCCTTGCTATGGGATTTGATGAAGAAAAAGTTGTCAAAGCCATTCAAGAACATGGAGAAGACAATATGGAAGCAATTGCAAATGCATTGCTCTCTTGTCCAGAGGCTAAGAAACTGCCAGCAGCAGTAGAGGAAGAAGATGGCATTGACTGGTCATCAAGTGATGATGATACCAATTACACCGATATGTTAAACTCAGATGATGAGAAAGATCCAAACTCAAATGAAAATGGCAGCAAAATACGGTCTTTGGTGAAGATGGGTTTCTCAGAGCTTGAAGCTTCTTTAGCTGTCGAGAGATGTGGAGAAAATGTGGATATTGCAGAGCTCACAGACTTCCTTTGTGCTGCTCAAATGGCTAGGGAATTTAGTGAGTTTTACACTGAACATGAAGAACAAAAGCCTAGACATAATATTAAGAAAAGGCGGTTTGAGTCAAAAGGAGAGCCAAGATCATCTGTTGATGACGAGCCGATTCGTCTACCAAATCCAATGATAGGATTTGGGGTTCCAAACGAGCCCGGACTCATTACACATAGATCGCTTCCAGAGTTAGCCCGAGGGCCACCTTTTTTCTACTATGAGAATGTCGCCCTCACACCTAAAGGCGTTTGGGAGACTATTTCCAGGCACTTGTTCGAGATCCCACCTGAGTTTGTGGACTCAAAATATTTCTGTGTTGCAGCGAGGAAGAGAGGCTACATCCACAATCTCCCCATCAACAACAGATTTCAGATTCAGCCTCCACCAAAATACACCATCCATGATGCATTTCCTTTGAGTAAGAGATGGTGGCCAGAATGGGATAAAAGGACCAAGCTTAATTGCATTTTGACTTGTACAGGTAGTGCTCAGTTGACTAACAGGATTCGTGTAGCCCTTGAGCCTTACAATGAAGAACCAGAACCGCCTAAGCATGTACAAAGATATGTGATTGACCAGTGCAAAAAATGGAATTTGGTTTGGGTGGGTAAAAACAAAGCTGCCCCACTCGAGCCAGATGAGATGGAGAGTATTCTGGGATTTCCAAAAAATCATACTCGTGGTGGAGGCATGAGTAGAACTGAGCGCTTCAAGTCCTTAGGAAATTCGTTTCAGGTTGATACTGTGGCGTATCATCTGTCTGTCCTGAAGCCCATTTTCCCACATGGAATCAATGTTCTCTCTCTTTTCACGGGTATTGGTGGTGGGGAAGTGGCACTTCATCGTCTCCAAATCAAAATGAAGCTTGTTGTGTCTGTTGAGATTTCAAAAGTCAACAGAAATATTTTGAAGGACTTTTGGGAGCAAACTAACCAGACTGGAGAATTGATCGAGTTTTCAGACATCCAACACTTGACTAATGACACAATCGAAGGGTTGATGGAGAAATATGGTGGATTTGATCTTGTAATTGGAGGAAGTCCTTGTAACAATCTGGCAGGCGGTAATAGGGTAAGCCGAGTTGGTCTTGAAGGTGATCAATCTTCGTTGTTCTTTGAGTATTGCCGTATTCTAGAGGTGGTACGTGCGAGGATGAGAGGATCTTGATCATTCACATTACCTGAAGTAGATTGAAGTAGATATGACTCCATGAAATCTAGTTGAACTTTATTTTTCTATATCTGTTATGTAATATGGCCATGAAGGTACATTTTTGAATAATATAAGTCAACCTAACTCTCTTTTGCTTTTTGCGACAATATATCTGCAACTGCATTTGCACTTTTCTCTTCCCTGCCTTAACACTGATGTTCAGTAATGTATTCAACCAGACAAATGTGTCATCATATAATCTTTGATCCTTCCTTCATGCGAAGGGTTAATGGAGAAATATGTTTGGGGTATTTGTATAGACACTTTGGTTAAGGAGTC

CDS Sequence

Protein Sequence