Gene Details:
- Gene ID: AT5G14380
- Gene Symbol: AGP6
- Gene Name: arabinogalactan protein 6
- Description: arabinogalactan protein 6;(source:Araport11)
- TAIR Accession: locus:2145713
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0025277 — pollen sac — saco polínico (Spanish, exact), 花粉のう (Japanese, exact), Poaceae microsporangium (narrow), Zea microsporangium (narrow), anther lobe (narrow)
Gene Ontology:
- GO:0009860 — acts upstream of or within — pollen tube growth
- GO:0010208 — involved in — pollen wall assembly
- GO:0031012 — located in — extracellular matrix
- GO:0016020 — located in — membrane
- GO:0005886 — located in — plasma membrane
Function-related keywords:
Literature:
- Glycosylphosphatidylinositol-anchored cell-surface proteins from Arabidopsis. DOI: 10.1002/(SICI)1522-2683(19990701)20:10<2027::AID-ELPS2027>3.0.CO;2-A ; PMID: 10451111
- Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis. DOI: 10.1104/pp.010884 ; PMID: 12068095
- Using genomic resources to guide research directions. The arabinogalactan protein gene family as a test case. DOI: 10.1104/pp.003459 ; PMID: 12177459
- Global identification of target genes regulated by APETALA3 and PISTILLATA floral homeotic gene action. DOI: 10.1105/tpc.006353 ; PMID: 12509532
- Comparative analysis of the Arabidopsis pollen transcriptome. DOI: 10.1104/pp.103.020925 ; PMID: 12805594
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- Transcriptional profiling of Arabidopsis tissues reveals the unique characteristics of the pollen transcriptome. DOI: 10.1104/pp.103.028241 ; PMID: 14500793
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- SETH1 and SETH2, two components of the glycosylphosphatidylinositol anchor biosynthetic pathway, are required for pollen germination and tube growth in Arabidopsis. DOI: 10.1105/tpc.014407 ; PMID: 14671020
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- AtSTP11, a pollen tube-specific monosaccharide transporter in Arabidopsis. DOI: 10.1007/s00425-004-1420-5 ; PMID: 15565288
- AtFLA11, a fasciclin-like arabinogalactan-protein, specifically localized in sclerenchyma cells. DOI: 10.1271/bbb.69.1963 ; PMID: 16244449
- Expression of arabinogalactan protein genes in pollen tubes of Arabidopsis thaliana. DOI: 10.1007/s00425-005-0137-4 ; PMID: 16228244
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Arabidopsis AT-hook protein TEK positively regulates the expression of arabinogalactan proteins in controlling nexine layer formation in the pollen wall. DOI: 10.1093/mp/ssu114 ; PMID: 25336567
- Arabidopsis AT-hook protein TEK positively regulates the expression of arabinogalactan proteins for Nexine formation. DOI: 10.1016/j.molp.2014.10.001 ; PMID: 25616387
- Glycosylphosphatidylinositol-anchored cell-surface proteins from Arabidopsis. DOI: 10.1002/(SICI)1522-2683(19990701)20:10<2027::AID-ELPS2027>3.0.CO;2-A ; PMID: 10451111
- Using genomic resources to guide research directions. The arabinogalactan protein gene family as a test case. DOI: 10.1104/pp.003459 ; PMID: 12177459
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
Sequences:
cDNA Sequence
- >AT5G14380.1
ATCCTAAAGCTTTTGCAGTATTTCTCCATAGAATAAGAAAAATAAAACAAAAATAAATAAATAAAAAATACTGCTTTAGCTTTTGGAGTATCCTCCTTTTAATCTCAATAAAAAAACTATTAAAACAGAAAAAAAAATGGCACGTCAATTTGTCGTTTTGGTTCTATTGACTTTAACTATCGCCACCGCTTTCGCCGCCGACGCTCCCTCAGCTTCTCCCAAAAAATCTCCATCACCCACTGCCGCACCAACCAAGGCTCCGACTGCCACAACCAAGGCTCCTTCAGCTCCAACCAAGGCTCCAGCCGCCGCACCTAAATCATCTTCGGCCTCTTCTCCAAAAGCATCTTCTCCGGCTGCCGAAGGACCCGTCCCCGAGGATGACTACTCTGCCTCTAGTCCTAGCGACTCTGCTGAGGCACCTACCGTCTCCTCCCCACCGGCTCCCACCCCCGACAGCACTTCCGCCGCTGATGGACCAAGCGATGGACCCACTGCAGAGTCACCCAAGAGTGGTGCCGTGACAACTGCTAAGTTCTCTGTTGTCGGCACAGTCGCCACCGTCGGCTTCTTCTTCTTTTCTTTCTAAGTTAAGTCGTCCACGTTTTGGTTGGATGGATCAGAGATTTGTATAATCTTTTGAGTTGAGGCCGTAAATTTATTTTATATATACGTTTATAAATCGAGATTAATTGGAGTAAATATAAACCTAAATGTCATTTTGAAATTTGGTTAGAACAAATTTTCATATTTTGTTTAATAAACTTATTTTTTTTGGAAATGCTTATGATTTGTGTGGTCTAATGGTCTTTTAGTTCCTATTGTCATGTGTTGTGAATTAGATATCATGAATGATATAAATGGATATTTCTACATTTTTATTTTAAAATTTTGTTGGCTAATACTAAATTGTGTACTATTTATAATATTCATGATAAAGGCTATTACACATTTTTAATCAAGTTAATAAATTTAGGATGCTTTAATGTACTAACCTCTTTTGGTGCCAAAGTCAGCCAATGTGTAAATACAA
CDS Sequence
Protein Sequence