Gene Details:
- Gene ID: AT5G14040
- Gene Symbol: MPT3, PHT3;1
- Gene Name: mitochondrial phosphate transporter 3, phosphate transporter 3;1
- Description: phosphate transporter 3;(source:Araport11)
- TAIR Accession: locus:2174688
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0009505 — located in — plant-type cell wall
- GO:0009651 — acts upstream of or within — response to salt stress
- GO:0035435 — involved in — phosphate ion transmembrane transport
- GO:0005739 — located in — mitochondrion
- GO:1990547 — involved in — mitochondrial phosphate ion transmembrane transport
- GO:0005315 — enables — inorganic phosphate transmembrane transporter activity
- GO:0000325 — located in — plant-type vacuole
- GO:0003729 — enables — mRNA binding
- GO:0009507 — located in — chloroplast
Function-related keywords:
Literature:
- Transcriptome analysis of root transporters reveals participation of multiple gene families in the response to cation stress. DOI: 10.1046/j.1365-313x.2003.01839.x ; PMID: 12969422
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- The Arabidopsis root transcriptome by serial analysis of gene expression. Gene identification using the genome sequence. DOI: 10.1104/pp.103.030536 ; PMID: 14730065
- Redundancy in the function of mitochondrial phosphate transport in Saccharomyces cerevisiae and Arabidopsis thaliana. DOI: 10.1046/j.1365-2958.2003.03810.x ; PMID: 14756774
- The growing family of mitochondrial carriers in Arabidopsis. DOI: 10.1016/j.tplants.2004.01.007 ; PMID: 15003237
- The hydrophobic proteome of mitochondrial membranes from Arabidopsis cell suspensions. DOI: 10.1016/j.phytochem.2004.03.028 ; PMID: 15276431
- Transcript profiling in the chl1-5 mutant of Arabidopsis reveals a role of the nitrate transporter NRT1.1 in the regulation of another nitrate transporter, NRT2.1. DOI: 10.1105/tpc.104.024380 ; PMID: 15319483
- Localization of organelle proteins by isotope tagging (LOPIT). DOI: 10.1074/mcp.T400009-MCP200 ; PMID: 15295017
- Folate metabolism in plants: an Arabidopsis homolog of the mammalian mitochondrial folate transporter mediates folate import into chloroplasts. DOI: 10.1074/jbc.M506045200 ; PMID: 16055441
- The cold-induced early activation of phospholipase C and D pathways determines the response of two distinct clusters of genes in Arabidopsis cell suspensions. DOI: 10.1104/pp.105.068171 ; PMID: 16258011
- Biosynthesis of cellulose-enriched tension wood in Populus: global analysis of transcripts and metabolites identifies biochemical and developmental regulators in secondary wall biosynthesis. DOI: 10.1111/j.1365-313X.2005.02584.x ; PMID: 16367961
- Mapping the Arabidopsis organelle proteome. DOI: 10.1073/pnas.0506958103 ; PMID: 16618929
- pho2, a phosphate overaccumulator, is caused by a nonsense mutation in a microRNA399 target gene. DOI: 10.1104/pp.106.078063 ; PMID: 16679417
- Genome-wide reprogramming of metabolism and regulatory networks of Arabidopsis in response to phosphorus. DOI: 10.1111/j.1365-3040.2006.01608.x ; PMID: 17177879
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Novel tonoplast transporters identified using a proteomic approach with vacuoles isolated from cauliflower buds. DOI: 10.1104/pp.107.096917 ; PMID: 17660356
- Host origin of plastid solute transporters in the first photosynthetic eukaryotes. DOI: 10.1186/gb-2007-8-10-r212 ; PMID: 17919328
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Identification and characterization of ADNT1, a novel mitochondrial adenine nucleotide transporter from Arabidopsis. DOI: 10.1104/pp.108.130310 ; PMID: 18923018
- Alteration of mitochondrial protein complexes in relation to metabolic regulation under short-term oxidative stress in Arabidopsis seedlings. DOI: 10.1016/j.phytochem.2010.11.003 ; PMID: 21146842
- Proteomics investigation of endogenous S-nitrosylation in Arabidopsis. DOI: 10.1016/j.bbrc.2011.11.036 ; PMID: 22115780
- The mitochondrial phosphate transporters modulate plant responses to salt stress via affecting ATP and gibberellin metabolism in Arabidopsis thaliana. DOI: 10.1371/journal.pone.0043530 ; PMID: 22937061
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- The hydrophobic proteome of mitochondrial membranes from Arabidopsis cell suspensions. DOI: 10.1016/j.phytochem.2004.03.028 ; PMID: 15276431
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Mapping the Arabidopsis organelle proteome. DOI: 10.1073/pnas.0506958103 ; PMID: 16618929
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
Sequences:
cDNA Sequence
- >AT5G14040.1
TCAGATTCCATTTGCCCAATAAAGCCCGAGTTTCGAGAGTTAATACCTCATTGGTGCTTTTGGTTTTGGCAAAGCGTGAGTGAGATCGGGAATCAAACATCGCCTCCGTCTCTCATTTCAAACGCTATCTCCATCTCCTTCCTCCGCCGCCGCCATGGAATCTCCGAAGAATTCTCTGATCCCGAGCTTCCTCTATTCATCATCTTCATCTCCGAGATCTTTCCTCCTCGACCAGGTGCTCAATTCCAACTCCAACGCTGCATTCGAGAAATCTCCTTCTCCGGCCCCGCGTTCCTCTCCTACGTCGATGATTTCTCGGAAGAATTTCCTTATTGCATCTCCCACCGAGCCAGGGAAGGGGATCGAGATGTATTCACCTGCCTTCTACGCTGCTTGTACCTTTGGTGGAATTCTCAGCTGTGGTCTTACTCACATGACCGTGACTCCTCTCGATCTCGTCAAGTGCAATATGCAGATTGATCCAGCGAAGTACAAGAGCATCTCGTCTGGTTTTGGAATTTTGCTGAAAGAGCAAGGAGTCAAAGGCTTTTTCCGTGGATGGGTTCCTACTCTTTTGGGTTACAGTGCTCAGGGTGCCTGCAAGTTTGGATTCTACGAGTACTTTAAGAAGACTTACTCTGACCTTGCTGGACCTGAGTACACTGCCAAATACAAGACTCTCATCTACCTTGCTGGTTCTGCTTCTGCTGAGATCATTGCCGATATTGCACTTTGCCCATTTGAAGCTGTGAAGGTTCGTGTTCAGACACAGCCTGGATTTGCTAGGGGGATGTCTGATGGATTTCCCAAGTTTATCAAGTCCGAAGGATACGGAGGCTTGTATAAGGGTCTTGCTCCACTCTGGGGACGTCAGATTCCTTACACTATGATGAAGTTTGCTTCCTTTGAGACCATTGTTGAGATGATTTACAAGTACGCAATCCCCAACCCAAAGAGTGAGTGCAGCAAAGGTCTGCAACTCGGAGTGAGTTTTGCCGGAGGTTACGTTGCCGGAGTGTTCTGTGCCATCGTTTCTCATCCAGCAGACAATCTAGTGTCATTCCTCAACAACGCTAAGGGAGCAACCGTTGGAGATGCGGTGAAGAAGATTGGTATGGTGGGACTGTTCACAAGAGGGCTTCCTCTTAGAATTGTGATGATCGGGACGTTGACTGGAGCACAGTGGGGATTATACGATGCCTTCAAAGTGTTTGTTGGCCTGCCAACCACTGGTGGTGTTGCTCCAGCTCCTGCCATCGCAGCTACTGAAGCCAAAGCCTAAACAATGACGAAAAAGGTTATTAGGAGTTCGATGGGGTAGGATTTTTGTTTGGAAAAATAAGAGAAACCATACGGTGATGAGGAAGAGTGAGTAAGCTCAATTTCTTCCTGATTTGAACTTTATCATTTTTGTTTTTTTTGAAATTTGTGTTCCTGAATTCAGGATAGTGCTCTCTCTCTCTTTACATACTCTCTTCCTATTGTTTCTTGTCCTTTTTTTCTTTGTGTGATGTAATCTTAAAAGATGAGAGGGACACACTCCAAGATAGAGAGAGTGGGCATACACCCACTCACTACTTTTTATTCAGTTTCAGTTGAAATTCTCTTTTGGTTGCTCTATCTATTATTTTACTTTTTTGTTTTAGAGATTATATAAAATCTCGTTTTAAAACATCAAATCATAGATAGATCTTGAAT
CDS Sequence
Protein Sequence