Information report for AT5G13930
Gene Details
|
|
Functional Descriptions
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- PO:0025181 — root elongation zone — zona de elongación de la raíz (Spanish, exact), 根伸長帯(層) (Japanese, exact)
- GO:0009715 — acts upstream of or within — chalcone biosynthetic process
- GO:0005515 — enables — protein binding
- GO:0009753 — acts upstream of or within — response to jasmonic acid
- GO:0009813 — involved in — flavonoid biosynthetic process
- GO:0009813 — acts upstream of or within — flavonoid biosynthetic process
- GO:0009926 — acts upstream of or within — auxin polar transport
- GO:0030639 — involved in — polyketide biosynthetic process
- GO:0005634 — located in — nucleus
- GO:0016747 — enables — acyltransferase activity, transferring groups other than amino-acyl groups
- GO:0031540 — acts upstream of or within — regulation of anthocyanin biosynthetic process
- GO:0009705 — located in — plant-type vacuole membrane
- GO:0005783 — located in — endoplasmic reticulum
- GO:0009733 — acts upstream of or within — response to auxin
- GO:0016210 — enables — naringenin-chalcone synthase activity
- GO:0102128 — enables — chalcone synthase activity
- GO:0009611 — acts upstream of or within — response to wounding
- GO:0009629 — acts upstream of or within — response to gravity
- GO:0010224 — acts upstream of or within — response to UV-B
- GO:0006979 — acts upstream of or within — response to oxidative stress
- GO:0005737 — located in — cytoplasm
- CS2105572 — yellow seeds (lacks brown pigment in seed coat), lacks anthocyanin in leaves and stems, lacks flavonols
- CS2105573 — yellow seeds (lacks brown pigment in seed coat), lacks anthocyanin in leaves and stems, lacks flavonols
- CS66119 — Colorless seed coat.
- CS66120 — Colorless seed coat.
- CS66121 — Colorless seed coat.
- CS71669 — Seeds have a pale transparent testa phenotype. Reduced cell wall rhamnose, but significantly more than the rhm1-3 single mutant (CS71668).
- CS71670 — Seeds have a pale transparent testa phenotype.
- CS85 — yellow seeds due to absence of brown pigment in seed coat (testa); pollen has a characteristic lemon-yellow color; anthocyanins absent in leaves, stems and all tissues, this is conspicuous in older plants when chlorophyll starts breaking down, and mutant plants are yellowish; deficient in chalcone synthase activity and lacks flavonoids.
- CS8584 — double mutant; disruption of the synthesis of brown pigment in seed coat (testa); yellow seeds.
- CS8585 — double mutant; disruption of the synthesis of brown pigment in seed coat (testa); yellow seeds.
- CS8590 — double mutant; disruption of the synthesis of brown pigment in seed coat (testa); yellow seeds.
- CS8592 — double mutant; disruption of the synthesis of brown pigment in seed coat (testa); yellow seeds.
- CS8597 — double mutant; disruption of the synthesis of brown pigment in seed coat (testa); yellow seeds.
- CS8602 — double mutant; altered phenylpropanoid metabolism; disruption of the synthesis of brown pigment in seed coat (testa), yellow seeds.
- CS8605 — yellow seeds (lacks brown pigment in seed coat), lacks anthocyanin in leaves and stems.
- tt4 — pale yellow seeds, no flavonoid in tapetum cells
Functional Keywords
Literature and News
- Induction of Arabidopsis tryptophan pathway enzymes and camalexin by amino acid starvation, oxidative stress, and an abiotic elicitor. DOI: 10.1105/tpc.10.3.359 ; PMID: 9501110
- Expression profiling reveals COI1 to be a key regulator of genes involved in and methyl jasmonate-induced secondary metabolism, defence, and hormone interactions. DOI: 10.1007/s11103-005-7306-5 ; PMID: 16021335
- Sucrose-specific induction of the anthocyanin biosynthetic pathway in Arabidopsis. DOI: 10.1104/pp.105.072579 ; PMID: 16384906
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Architectural phenotypes in the transparent testa mutants of Arabidopsis thaliana. DOI: 10.1093/jxb/ern323 ; PMID: 19129166
- RED AND FAR-RED INSENSITIVE 2, a RING-domain zinc finger protein, mediates phytochrome-controlled seedling deetiolation responses. DOI: 10.1104/pp.105.073163 ; PMID: 16384903
- Effect of magnetic fields on cryptochrome-dependent responses in Arabidopsis thaliana. DOI: 10.1098/rsif.2008.0519 ; PMID: 19324677
- The endogenous GL3, but not EGL3, gene is necessary for anthocyanin accumulation as induced by nitrogen depletion in Arabidopsis rosette stage leaves. DOI: 10.1007/s00425-009-0978-3 ; PMID: 19621239
- Accumulation of flavonoids in an ntra ntrb mutant leads to tolerance to UV-C. DOI: 10.1093/mp/ssn065 ; PMID: 19825611
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- Features of anthocyanin biosynthesis in pap1-D and wild-type Arabidopsis thaliana plants grown in different light intensity and culture media conditions. DOI: 10.1007/s00425-010-1142-9 ; PMID: 20309578
- High frequency targeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases. DOI: 10.1073/pnas.0914991107 ; PMID: 20508152
- The growth reduction associated with repressed lignin biosynthesis in Arabidopsis thaliana is independent of flavonoids. DOI: 10.1105/tpc.110.074161 ; PMID: 20511296
- HYPOSENSITIVE TO LIGHT, an alpha/beta fold protein, acts downstream of ELONGATED HYPOCOTYL 5 to regulate seedling de-etiolation. DOI: 10.1093/mp/ssq055 ; PMID: 20864454
- Engineering traditional monolignols out of lignin by concomitant up-regulation of F5H1 and down-regulation of COMT in Arabidopsis. DOI: 10.1111/j.1365-313X.2010.04353.x ; PMID: 20822504
- Simple construction of plant RNAi vectors using long oligonucleotides. DOI: 10.1007/s10265-009-0228-6 ; PMID: 19347568
- Metabolomics reveals comprehensive reprogramming involving two independent metabolic responses of Arabidopsis to UV-B light. DOI: 10.1111/j.1365-313X.2011.04599.x ; PMID: 21466600
- Overexpression of a resveratrol synthase gene (PcRS) from Polygonum cuspidatum in transgenic Arabidopsis causes the accumulation of trans-piceid with antifungal activity. DOI: 10.1007/s00299-011-1110-2 ; PMID: 21717185
- A large-scale genetic screen in Arabidopsis to identify genes involved in pollen exine production. DOI: 10.1104/pp.111.179523 ; PMID: 21849515
- Feedback inhibition of the general phenylpropanoid and flavonol biosynthetic pathways upon a compromised flavonol-3-O-glycosylation. DOI: 10.1093/jxb/err416 ; PMID: 22249996
- UVR8 mediates UV-B-induced Arabidopsis defense responses against Botrytis cinerea by controlling sinapate accumulation. DOI: 10.1093/mp/sss025 ; PMID: 22447155
- Phosphorylation of FAR-RED ELONGATED HYPOCOTYL1 is a key mechanism defining signaling dynamics of phytochrome A under red and far-red light in Arabidopsis. DOI: 10.1105/tpc.112.097733 ; PMID: 22582101
- Analysis of T-DNA alleles of flavonoid biosynthesis genes in Arabidopsis ecotype Columbia. DOI: 10.1186/1756-0500-5-485 ; PMID: 22947320
- Analyses of tropistic responses using metabolomics. DOI: 10.3732/ajb.1200316 ; PMID: 23196394
- Increasing frequencies of site-specific mutagenesis and gene targeting in Arabidopsis by manipulating DNA repair pathways. DOI: 10.1101/gr.145557.112 ; PMID: 23282329
- Both cyclic-AMP and cyclic-GMP can act as regulators of the phenylpropanoid pathway in Arabidopsis thaliana seedlings. DOI: 10.1016/j.plaphy.2013.05.029 ; PMID: 23774376
- The UVR8 UV-B Photoreceptor: Perception, Signaling and Response. DOI: 10.1199/tab.0164 ; PMID: 23864838
- Targeted mutagenesis of Arabidopsis thaliana using engineered TAL effector nucleases. DOI: 10.1534/g3.113.007104 ; PMID: 23979944
- TCP3 interacts with R2R3-MYB proteins, promotes flavonoid biosynthesis and negatively regulates the auxin response in Arabidopsis thaliana. DOI: 10.1111/tpj.12348 ; PMID: 24118612
- Regulation of anthocyanin biosynthesis in Arabidopsis thaliana red pap1-D cells metabolically programmed by auxins. DOI: 10.1007/s00425-013-2011-0 ; PMID: 24370633
- A R2R3-MYB transcription factor, GmMYB12B2, affects the expression levels of flavonoid biosynthesis genes encoding key enzymes in transgenic Arabidopsis plants. DOI: 10.1016/j.gene.2013.09.015 ; PMID: 24060295
- Enhancement of oxidative and drought tolerance in Arabidopsis by overaccumulation of antioxidant flavonoids. DOI: 10.1111/tpj.12388 ; PMID: 24274116
- UV-B inhibition of hypocotyl growth in etiolated Arabidopsis thaliana seedlings is a consequence of cell cycle arrest initiated by photodimer accumulation. DOI: 10.1093/jxb/eru035 ; PMID: 24591052
- Nitric oxide plays a role in stem cell niche homeostasis through its interaction with auxin. DOI: 10.1104/pp.114.247445 ; PMID: 25315603
- Peroxidase 4 is involved in syringyl lignin formation in Arabidopsis thaliana. DOI: 10.1016/j.jplph.2014.11.006 ; PMID: 25506770
- AtROS1 overexpression provides evidence for epigenetic regulation of genes encoding enzymes of flavonoid biosynthesis and antioxidant pathways during salt stress in transgenic tobacco. DOI: 10.1093/jxb/erv304 ; PMID: 26116024
- Exogenous adenosine 5'-phosphoramidate behaves as a signal molecule in plants; it augments metabolism of phenylpropanoids and salicylic acid in Arabidopsis thaliana seedlings. DOI: 10.1016/j.plaphy.2015.05.013 ; PMID: 26079287
- Phytochrome-interacting factors PIF4 and PIF5 negatively regulate anthocyanin biosynthesis under red light in Arabidopsis seedlings. DOI: 10.1016/j.plantsci.2015.06.001 ; PMID: 26259175
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Two MYB-related transcription factors play opposite roles in sugar signaling in Arabidopsis. DOI: 10.1007/s11103-016-0562-8 ; PMID: 27866313
- Calmodulin-binding protein CBP60g functions as a negative regulator in Arabidopsis anthocyanin accumulation. DOI: 10.1371/journal.pone.0173129 ; PMID: 28253311
- A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis. DOI: 10.1105/tpc.16.00855 ; PMID: 28446542
- Sugar Potentiation of Fatty Acid and Triacylglycerol Accumulation. DOI: 10.1104/pp.17.00828 ; PMID: 28842550
- Responses of He-Ne laser on agronomic traits and the crosstalk between UVR8 signaling and phytochrome B signaling pathway in Arabidopsis thaliana subjected to supplementary ultraviolet-B (UV-B) stress. DOI: 10.1007/s00709-017-1184-y ; PMID: 29138939
- Perception of Sunflecks by the UV-B Photoreceptor UV RESISTANCE LOCUS8. DOI: 10.1104/pp.18.00048 ; PMID: 29530938
- TRANSPARENT TESTA 4-mediated flavonoids negatively affect embryonic fatty acid biosynthesis in Arabidopsis. DOI: 10.1111/pce.13402 ; PMID: 29981254
- The COP1 Target SHI-RELATED SEQUENCE5 Directly Activates Photomorphogenesis-Promoting Genes. DOI: 10.1105/tpc.18.00455 ; PMID: 30150309
- The Peroxidative Cleavage of Kaempferol Contributes to the Biosynthesis of the Benzenoid Moiety of Ubiquinone in Plants. DOI: 10.1105/tpc.18.00688 ; PMID: 30429224
- Impact of UV-B radiation on the photosystem II activity, pro-/antioxidant balance and expression of light-activated genes in Arabidopsis thaliana hy4 mutants grown under light of different spectral composition. DOI: 10.1016/j.jphotobiol.2019.02.003 ; PMID: 30897399
- Chitin synthase is involved in vegetative growth, asexual reproduction and pathogenesis of Phytophthora capsici and Phytophthora sojae. DOI: 10.1111/1462-2920.14744 ; PMID: 31314944
- Melatonin acts synergistically with auxin to promote lateral root development through fine tuning auxin transport in Arabidopsis thaliana. DOI: 10.1371/journal.pone.0221687 ; PMID: 31461482
- Involvement of the eIF2α Kinase GCN2 in UV-B Responses. DOI: 10.3389/fpls.2019.01492 ; PMID: 31850012
- Integrated bioinformatics analyses identified SCL3-induced regulatory network in Arabidopsis thaliana roots. DOI: 10.1007/s10529-020-02850-z ; PMID: 32125580
- Kingdom-wide analysis of the evolution of the plant type III polyketide synthase superfamily. DOI: 10.1093/plphys/kiaa086 ; PMID: 33793871
- Involvement of the R2R3-MYB transcription factor MYB21 and its homologs in regulating flavonol accumulation in Arabidopsis stamen. DOI: 10.1093/jxb/erab156 ; PMID: 33831169
- Insights into the Role of Transcriptional Gene Silencing in Response to Herbicide-Treatments in Arabidopsis thaliana. DOI: 10.3390/ijms22073314 ; PMID: 33804990
- UV and blue light signalling: pathways regulating chalcone synthase gene expression in Arabidopsis. DOI: 10.1046/j.1469-8137.2001.00151.x ; PMID: 33873370
- A dual-specificity phosphatase, MAP kinase phosphatase 1, positively regulates blue light-mediated seedling development in Arabidopsis. DOI: 10.1007/s00425-021-03649-6 ; PMID: 34057637
- Photoprotection of Arabidopsis leaves under short-term high light treatment: The antioxidant capacity is more important than the anthocyanin shielding effect. DOI: 10.1016/j.plaphy.2021.06.006 ; PMID: 34126593
- External dsRNA Downregulates Anthocyanin Biosynthesis-Related Genes and Affects Anthocyanin Accumulation in Arabidopsis thaliana. DOI: 10.3390/ijms22136749 ; PMID: 34201713
- Proteomic characterization of isolated Arabidopsis clathrin-coated vesicles reveals evolutionarily conserved and plant-specific components. DOI: 10.1093/plcell/koac071 ; PMID: 35218346
- Elucidating connections between the strigolactone biosynthesis pathway, flavonoid production and root system architecture in Arabidopsis thaliana. DOI: 10.1111/ppl.13681 ; PMID: 35362177
- BBX24 Interacts with DELLA to Regulate UV-B-Induced Photomorphogenesis in Arabidopsis thaliana. DOI: 10.3390/ijms23137386 ; PMID: 35806395
- ARF2 positively regulates flavonols and proanthocyanidins biosynthesis in Arabidopsis thaliana. DOI: 10.1007/s00425-022-03936-w ; PMID: 35857143
- The Plastidial DIG5 Protein Affects Lateral Root Development by Regulating Flavonoid Biosynthesis and Auxin Transport in Arabidopsis. DOI: 10.3390/ijms231810642 ; PMID: 36142550
- Maternal control of triploid seed development by the TRANSPARENT TESTA 8 (TT8) transcription factor in Arabidopsis thaliana. DOI: 10.1038/s41598-023-28252-5 ; PMID: 36693864
- RNAseq-Based Working Model for Transcriptional Regulation of Crosstalk between Simultaneous Abiotic UV-B and Biotic Stresses in Plants. DOI: 10.3390/genes14020240 ; PMID: 36833168
- Induction of Arabidopsis tryptophan pathway enzymes and camalexin by amino acid starvation, oxidative stress, and an abiotic elicitor. DOI: 10.1105/tpc.10.3.359 ; PMID: 9501110
- Analysis of Arabidopsis mutants deficient in flavonoid biosynthesis. DOI: 10.1046/j.1365-313x.1995.08050659.x ; PMID: 8528278
- Cloning of the chrysanthemum UEP1 promoter and comparative expression in florets and leaves of Dendranthema grandiflora. DOI: 10.1023/a:1016313924844 ; PMID: 12212845
- Induced plant responses to pathogen attack. Analysis and heterologous expression of the key enzyme in the biosynthesis of phytoalexins in soybean (Glycine max L. Merr. cv. Harosoy 63). DOI: 10.1111/j.1432-1033.1991.tb15833.x ; PMID: 1840523
- Arabidopsis AtGSTF2 is regulated by ethylene and auxin, and encodes a glutathione S-transferase that interacts with flavonoids. DOI: 10.1046/j.1365-313x.2003.01890.x ; PMID: 14617075
- Genome stability of vtc1, tt4, and tt5 Arabidopsis thaliana mutants impaired in protection against oxidative stress. DOI: 10.1111/j.1365-313X.2004.02020.x ; PMID: 15053760
- Variation in expression and protein localization of the PIN family of auxin efflux facilitator proteins in flavonoid mutants with altered auxin transport in Arabidopsis thaliana. DOI: 10.1105/tpc.021501 ; PMID: 15208397
- HYPERSENSITIVE TO RED AND BLUE 1, a ZZ-type zinc finger protein, regulates phytochrome B-mediated red and cryptochrome-mediated blue light responses. DOI: 10.1105/tpc.104.029165 ; PMID: 15705950
- Two homologous ATP-binding cassette transporter proteins, AtMDR1 and AtPGP1, regulate Arabidopsis photomorphogenesis and root development by mediating polar auxin transport. DOI: 10.1104/pp.105.061572 ; PMID: 15908594
- Anthocyanin accumulation and changes in CHS and PR-5 gene expression in Arabidopsis thaliana after removal of the inflorescence stem (decapitation). DOI: 10.1016/j.plaphy.2005.05.004 ; PMID: 15993620
- Volatile C6-aldehydes and Allo-ocimene activate defense genes and induce resistance against Botrytis cinerea in Arabidopsis thaliana. DOI: 10.1093/pcp/pci122 ; PMID: 15879447
- Expression profiling reveals COI1 to be a key regulator of genes involved in and methyl jasmonate-induced secondary metabolism, defence, and hormone interactions. DOI: 10.1007/s11103-005-7306-5 ; PMID: 16021335
- MAX1, a regulator of the flavonoid pathway, controls vegetative axillary bud outgrowth in Arabidopsis. DOI: 10.1073/pnas.0509463102 ; PMID: 16387852
- Arabidopsis SHORT HYPOCOTYL UNDER BLUE1 contains SPX and EXS domains and acts in cryptochrome signaling. DOI: 10.1105/tpc.105.037879 ; PMID: 16500988
- Over-expression of a flower-specific transcription factor gene AtMYB24 causes aberrant anther development. DOI: 10.1007/s00299-006-0229-z ; PMID: 16972096
- Deficiency in phylloquinone (vitamin K1) methylation affects prenyl quinone distribution, photosystem I abundance, and anthocyanin accumulation in the Arabidopsis AtmenG mutant. DOI: 10.1074/jbc.M609412200 ; PMID: 17082184
- Flavonoid accumulation in Arabidopsis repressed in lignin synthesis affects auxin transport and plant growth. DOI: 10.1105/tpc.106.044495 ; PMID: 17237352
- Analysis of transcription factor HY5 genomic binding sites revealed its hierarchical role in light regulation of development. DOI: 10.1105/tpc.106.047688 ; PMID: 17337630
- Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in different parts of the Arabidopsis thaliana seedling. DOI: 10.1111/j.1365-313X.2007.03078.x ; PMID: 17419845
- Separating the roles of acropetal and basipetal auxin transport on gravitropism with mutations in two Arabidopsis multidrug resistance-like ABC transporter genes. DOI: 10.1105/tpc.107.051599 ; PMID: 17557805
- Salt tolerance (STO), a stress-related protein, has a major role in light signalling. DOI: 10.1111/j.1365-313X.2007.03162.x ; PMID: 17605755
- Identification of a novel cis-regulatory element for UV-B-induced transcription in Arabidopsis. DOI: 10.1111/j.1365-313X.2008.03435.x ; PMID: 18266923
Gene Resources
- UniProt: Q460R0
- EMBL: DQ062385, DQ062387, DQ062388
- AlphaFoldDB: Q460R0
- EnsemblPlants: AT5G13930.1
- Gramene: AT5G13930.1
- KEGG: ath:AT5G13930
- Orthologous matrix: HGWQDRM
- ExpressionAtlas: AT5G13930
Sequences
cDNA Sequence
- >AT5G13930.1
GTTGCAAATATATAAATCAATCAAAAGATTTAAAACCCACCATTCAATCTTGGTAAGTAACGAAAAAAAAGGGAAGCAAGAAGAACCACAGAAAAGGGGGCTAACAACTAGACACGTAGATCTTCATCTGCCCGTCCATCTAACCTACCACACTCTCATCTTCTTTTTCCCGTGTCAGTTTGTTATATAAGCTCTCACTCTCCGGTATATTTCCAAATACACCTAACTTGTTTAGTACACAACAGCAACATCAAACTCTAATAAACCCAAGTTGGTGTATACTATAATGGTGATGGCTGGTGCTTCTTCTTTGGATGAGATCAGACAGGCTCAGAGAGCTGATGGACCTGCAGGCATCTTGGCTATTGGCACTGCTAACCCTGAGAACCATGTGCTTCAGGCGGAGTATCCTGACTACTACTTCCGCATCACCAACAGTGAACACATGACCGACCTCAAGGAGAAGTTCAAGCGCATGTGCGACAAGTCGACAATTCGGAAACGTCACATGCATCTGACGGAGGAATTCCTCAAGGAAAACCCACACATGTGTGCTTACATGGCTCCTTCTCTGGACACCAGACAGGACATCGTGGTGGTCGAAGTCCCTAAGCTAGGCAAAGAAGCGGCAGTGAAGGCCATCAAGGAGTGGGGCCAGCCCAAGTCAAAGATCACTCATGTCGTCTTCTGCACTACCTCCGGCGTCGACATGCCTGGTGCTGACTACCAGCTCACCAAGCTTCTTGGTCTCCGTCCTTCCGTCAAGCGTCTCATGATGTACCAGCAAGGTTGCTTCGCCGGCGGTACTGTCCTCCGTATCGCTAAGGATCTCGCCGAGAACAATCGTGGAGCACGTGTCCTCGTTGTCTGCTCTGAGATCACAGCCGTTACCTTCCGTGGTCCCTCTGACACCCACCTTGACTCCCTCGTCGGTCAGGCTCTTTTCAGTGATGGCGCCGCCGCACTCATTGTGGGGTCGGACCCTGACACATCTGTCGGAGAGAAACCCATCTTTGAGATGGTGTCTGCCGCTCAGACCATCCTTCCAGACTCTGATGGTGCCATAGACGGACATTTGAGGGAAGTTGGTCTCACCTTCCATCTCCTCAAGGATGTTCCCGGCCTCATCTCCAAGAACATTGTGAAGAGTCTAGACGAAGCGTTTAAACCTTTGGGGATAAGTGACTGGAACTCCCTCTTCTGGATAGCCCACCCTGGAGGTCCAGCGATCCTAGACCAGGTGGAGATAAAGCTAGGACTAAAGGAAGAGAAGATGAGGGCGACACGTCACGTGTTGAGCGAGTATGGAAACATGTCGAGCGCGTGCGTTCTCTTCATACTAGACGAGATGAGGAGGAAGTCAGCTAAGGATGGTGTGGCCACGACAGGAGAAGGGTTGGAGTGGGGTGTCTTGTTTGGTTTCGGACCAGGTCTCACTGTTGAGACAGTCGTCTTGCACAGCGTTCCTCTCTAAACAGAACGCTTGCCTTCTATCTGCCTACCTACCTACGCAAAACTTTAATCCTGTCTTATGTTTTATATAATATAATCATTATATGTTTACGCAATAATTAAGGAAGAATTCATTTGATGTGATATGTGATATGTGCTGGACAGGTCTATTCGACTGTTTTTGTACTCTCTTTTTTGTGTCTTTTTACAATATTAAATCTATGGGTCTTGAATGACATCAAATCTTTGTT
CDS Sequence
Protein Sequence