Gene Details:
- Gene ID: AT5G13910
- Gene Symbol: LEP
- Gene Name: LEAFY PETIOLE
- Description: Integrase-type DNA-binding superfamily protein;(source:Araport11)
- TAIR Accession: locus:2159068
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000017 — vascular leaf primordium — leaf primordium (exact), portion of vascular leaf primordium tissue (exact), primordio de hoja (Spanish, exact), vascular leaf primordia (exact, plural), 葉原基 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
Gene Ontology:
- GO:0009739 — acts upstream of or within — response to gibberellin
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0010030 — acts upstream of or within — positive regulation of seed germination
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0005634 — located in — nucleus
- GO:0006355 — involved in — regulation of DNA-templated transcription
Germplasm Phenotype:
- lep-1 — No aberrant adult phenotypes.
- lep-1 — Shorter hypocotyls in the light and dark. Light-grown cotyledons are smaller than wild type.
Function-related keywords:
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The Arabidopsis transcription factor HY5 integrates light and hormone signaling pathways. DOI: 10.1111/j.1365-313X.2004.02052.x ; PMID: 15078335
- A new role for the Arabidopsis AP2 transcription factor, LEAFY PETIOLE, in gibberellin-induced germination is revealed by the misexpression of a homologous gene, SOB2/DRN-LIKE. DOI: 10.1105/tpc.105.036707 ; PMID: 16339853
- The barley ERF-type transcription factor HvRAF confers enhanced pathogen resistance and salt tolerance in Arabidopsis. DOI: 10.1007/s00425-006-0373-2 ; PMID: 16937017
- Genome-wide expression profiling of ARABIDOPSIS RESPONSE REGULATOR 7(ARR7) overexpression in cytokinin response. DOI: 10.1007/s00438-006-0177-x ; PMID: 17061125
- A survey of dominant mutations in Arabidopsis thaliana. DOI: 10.1016/j.tplants.2012.08.006 ; PMID: 22995285
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- Establishment of Expression in the SHORTROOT-SCARECROW Transcriptional Cascade through Opposing Activities of Both Activators and Repressors. DOI: 10.1016/j.devcel.2016.09.031 ; PMID: 27923776
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- An annotation update via cDNA sequence analysis and comprehensive profiling of developmental, hormonal or environmental responsiveness of the Arabidopsis AP2/EREBP transcription factor gene family. DOI: 10.1007/s11103-005-1511-0 ; PMID: 16307362
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
- A new role for the Arabidopsis AP2 transcription factor, LEAFY PETIOLE, in gibberellin-induced germination is revealed by the misexpression of a homologous gene, SOB2/DRN-LIKE. DOI: 10.1105/tpc.105.036707 ; PMID: 16339853
- Genome-wide analysis of the ERF gene family in Arabidopsis and rice. DOI: 10.1104/pp.105.073783 ; PMID: 16407444
Sequences:
cDNA Sequence
- >AT5G13910.1
GAAAAAGGAAAGGTATAGCTCTTATATAAAAGGGTTGTGGTAAGGGATACTTTTCCAAGACCAACACACATTCCCTCTCTTCCTTCAACTAGAAAAAAGATAGATATATCGGACATTTATTGATCTGTGTATGCATAAAGGTATAGTATCATTATTAGAAAGATGAACACAACATCATCAAAGAGCAAGAAGAAGCAAGACGATCAGGTTGGTACAAGGTTTCTTGGGGTGAGAAGAAGGCCTTGGGGAAGATACGCAGCTGAGATTAGAGACCCAACTACGAAGGAGCGTCACTGGCTTGGCACTTTCGATACGGCGGAAGAAGCTGCCTTGGCCTACGATAGAGCTGCTCGGTCCATGCGTGGCACACGTGCCAGAACCAACTTTGTTTACTCAGACATGCCTCCTTCCTCATCCGTCACCTCCATTGTTTCTCCTGACGATCCTCCTCCTCCTCCACCTCCTCCTGCTCCTCCTAGCAATGATCCTGTCGATTACATGATGATGTTTAACCAATACTCATCCACTGACTCGCCAATGCTTCAGCCTCATTGTGATCAAGTGGACAGTTACATGTTTGGTGGCTCTCAATCTTCGAATTCTTATTGCTATTCTAATGACAGTAGTAATGAGCTGCCTCCTCTCCCGAGCGACTTGTCGAATTCGTGTTATAGCCAACCACAGTGGACCTGGACCGGTGACGACTACTCGTCTGAGTACGTACATAGTCCAATGTTCAGCAGAATGCCTCCGGTTTCTGACTCTTTCCCTCAAGGTTTCAACTACTTTGGCTCCTAATTCTTTCTCATCGTCCATATTTAATACCTTCCTCATTTGTACCTTTTCCTTCTTCTTCTTTTTTGGGTTTATCTATGTTTCGCCGTCCTTGATCTCTGCCTATGTGATCAAAGTGACTGTTTGTCATTAGTTTTTCAATAACAAGTTATCATTTGTATCTTGATTAATGAAAACAAGAAACTGCTCTTGTGTTACTTTCAAATACATATTTAATATATATGGGCCTTGGACATCAAAAGCCCATTATTCGATGGGTTATTAGTTGGCATGACATACTTTGTATAGCCCAAACCTCTGTGTGTTTTTCTTATGGTTGAACGAG
CDS Sequence
Protein Sequence