Gene Details:
- Gene ID: AT5G13510
- Gene Symbol: EMB3136, uL10c
- Gene Name: EMBRYO DEFECTIVE 3136, Ribosomal Protein uL10c
- Description: Ribosomal protein L10 family protein;(source:Araport11)
- TAIR Accession: locus:2185051
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0009570 — located in — chloroplast stroma
- GO:0009507 — located in — chloroplast
- GO:0009536 — located in — plastid
- GO:0022626 — located in — cytosolic ribosome
- GO:0006412 — involved in — translation
- GO:0015934 — part of — large ribosomal subunit
- GO:0009941 — located in — chloroplast envelope
- GO:0003735 — enables — structural constituent of ribosome
Function-related keywords:
Literature:
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Comparative analysis of bacterial-origin genes for plant mitochondrial ribosomal proteins. DOI: 10.1093/molbev/msj080 ; PMID: 16368778
- An extensive (co-)expression analysis tool for the cytochrome P450 superfamily in Arabidopsis thaliana. DOI: 10.1186/1471-2229-8-47 ; PMID: 18433503
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Identification of nuclear genes encoding chloroplast-localized proteins required for embryo development in Arabidopsis. DOI: 10.1104/pp.110.168120 ; PMID: 21139083
- CHLOROPLAST RIBOSOME ASSOCIATED Supports Translation under Stress and Interacts with the Ribosomal 30S Subunit. DOI: 10.1104/pp.18.00602 ; PMID: 29914890
- Genome-wide identification of EMBRYO-DEFECTIVE (EMB) genes required for growth and development in Arabidopsis. DOI: 10.1111/nph.16071 ; PMID: 31334862
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
Sequences:
cDNA Sequence
- >AT5G13510.1
AGAAACAGTCTCCTCATCTTCTGAGCAAAAAAATGGAAGTGGCTCTTCTCTCCTTCTCTTCTTCCTTGTCTCCTCTCTGTCACCAGCGAATCTCAACTCTCACACCCAAAACCTCGAATTCCCCAAATTACCCTCGCCTCCCGGTCATCAGATCCGCGGTGTCTCGTAACAAGAAGGAAGAGACTGTCGAAGCCGTCAAGTCTCACTTGGAGAACTGCCATCTCCTCGCCGCCATCAACTACAAAGGCCTCACCGTCAAGCAGTTTCAAGACCTCCGGAGAACTCTCCCCGACACTACAAAGCTCATCGTCGCCAAGAACACTTTGGTCTTCAAAGCCATTGAAGGCACCAAATGGGAAGCTCTCAAGCCTTGTATGAAAGGCATGAACGCTTGGCTTTTCGTCCAGACCGATGAAATCCCTTCTGCTATCAAACCCTACCGGAGCTTCCAGAAGGAACGCAAGCTTGAAAACAATGACTTTGCCGGCGCTGTCTTCGAAGGTAAGTTCTACGCTCCTGACAATTTCAAAGTCCTCGAGACCATGCCCACTCGTGCTGAGGTCTACGCTAAGATGCTCGGTGCTCTGCAATCTCCGGCTATTAATCTCGTCACTACTTTACAAGCACCAGCAAGAGAGGTTATAATGGTGCTTATGGCTTACATTAAGAAGTTGGAAGATGAGAGTAATGCATAGTTAAGCTTGTACTAATCTTTTGGAGAATGTAATGTACGCAACAAAAGGCAATTCAATTTTTTGTTTATGACTCTCTCAAGCACCAATTGTTATTACAGTGACTGAGTTTTATTGAAATGTTGTTTTTCGGAGTGCTCTC
CDS Sequence
Protein Sequence