Information report for AT5G13450
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0005020 — vascular bundle — haz vascular (Spanish, exact), vein (exact), 維管束 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- GO:0009507 — located in — chloroplast
- GO:0005739 — located in — mitochondrion
- GO:0015986 — involved in — proton motive force-driven ATP synthesis
- GO:0000274 — part of — mitochondrial proton-transporting ATP synthase, stator stalk
- GO:0000275 — part of — mitochondrial proton-transporting ATP synthase complex, catalytic sector F(1)
- GO:0046933 — enables — proton-transporting ATP synthase activity, rotational mechanism
- GO:0009536 — located in — plastid
- GO:0046933 — contributes to — proton-transporting ATP synthase activity, rotational mechanism
- GO:0042776 — involved in — proton motive force-driven mitochondrial ATP synthesis
- GO:0045261 — part of — proton-transporting ATP synthase complex, catalytic core F(1)
- GO:0005753 — part of — mitochondrial proton-transporting ATP synthase complex
- GO:0008270 — enables — zinc ion binding
- GO:0050897 — enables — cobalt ion binding
Functional Keywords
Literature and News
- Analysis of the Arabidopsis mitochondrial proteome. DOI: 6919 ; PMID: 11743115
- Proteomic approach to identify novel mitochondrial proteins in Arabidopsis. DOI: 6987 ; PMID: 11743114
- The products of the mitochondrial orf25 and orfB genes are FO components in the plant F1FO ATP synthase. DOI: 10.1016/s0014-5793(03)00264-3 ; PMID: 12681508
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Clp protease complexes from photosynthetic and non-photosynthetic plastids and mitochondria of plants, their predicted three-dimensional structures, and functional implications. DOI: 10.1074/jbc.M309212200 ; PMID: 14593120
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- Resolving and identifying protein components of plant mitochondrial respiratory complexes using three dimensions of gel electrophoresis. DOI: 10.1021/pr700595p ; PMID: 18189341
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Antisense expression of mitochondrial ATP synthase subunits OSCP (ATP5) and gamma (ATP3) alters leaf morphology, metabolism and gene expression in Arabidopsis. DOI: 10.1093/pcp/pcp125 ; PMID: 19748911
- Divalent metal ions in plant mitochondria and their role in interactions with proteins and oxidative stress-induced damage to respiratory function. DOI: 10.1104/pp.109.147942 ; PMID: 20018591
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- Analysis of the Arabidopsis mitochondrial proteome. DOI: 6919 ; PMID: 11743115
- Proteomic approach to identify novel mitochondrial proteins in Arabidopsis. DOI: 6987 ; PMID: 11743114
- The products of the mitochondrial orf25 and orfB genes are FO components in the plant F1FO ATP synthase. DOI: 10.1016/s0014-5793(03)00264-3 ; PMID: 12681508
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- The hydrophobic proteome of mitochondrial membranes from Arabidopsis cell suspensions. DOI: 10.1016/j.phytochem.2004.03.028 ; PMID: 15276431
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
Gene Resources
Sequences
cDNA Sequence
- >AT5G13450.1
AGTGAAGCCCAATGCACTAAGTTATTTTCTTCCTCTGACCAGTTTCATCTCTTTGCTCTCGACAAAGCAGCTGAGCGACTTTTGCACATTTCTAGGGTTCCAATCAAAATCTATCTGCAACAAAAATGGCTAATCGTTTCAGATCAGGGATCTCCTTCTTCAAGACCATCGCCGTAACAGATTCTGTCTCCTCCGTTAGATCCAAGTCGCTTTTCCCAGCGTTGAGAACTTATGCAACTGCTTCTGCTCAAACAACCGCTAATGTTAAGGTGCCTATTGCTTTAGTTGGTGAAAATGGGAACTTTGCTTCATGGCTATACATTGCAGCTGTGAAAATGAATTCCTTGGAAAAGATTGAGACGGATCTTTCTGAGATGATTGAGGCAATGAAGACAGCTCCTATTTTTGCTCAGTTTACAAAGGATCCCTCTGTTCCTAGAGGGACAAGATTGGCTGCTATTAGGGATGCTTGTGATCAAGCAAAGTTTGCCGAACCCACTAAGAACTTCCTCTCTTTGTTAGCTGAGAATGGAAAGCTGAAGAACCTAGATGCCATTGTGAAGAAATTTATGCAGCTGACAAACGCACATAGGGGAGATGTCAAAGTTTTGGTTACCACAGTCATTCCGCTTCCCCCTGCTGAGGAGAAAGAACTGACTGAGACGCTTCAGGAGATCATTGGAGCAGGGAAGAAAATCACTGTGGAACAAAAGATTGATCCAAGTATCTACGGTGGACTAATCGTAGAGTTCCAACAAAAGGTGTTGGACATGTCAATCAGGACAAGGGCACAACAGATGGAGAGGCTCCTCCGTGAACCTGTTGACTTCAACAACCTCTGAAAATCTTGAGAGAAATTTCCCCCAAGAAAACATGCTTGTGATGAATGCCACCAATTGACAAATAAATATGGACCCTCCTGGGAAACAATATAATAGCTGGCCACTTCTCTCCCTTTGAATTTTGTCATTTGCTTTTTACATATTGTTGTTTGCTTCGAAATAAAGCTTTTCGAGACATCAAATTTCAATGAGATTGTTTTTGTTTAGATTTGAATCGTTGGGCTAATTTGGTAAATAAATCTACAAACTATGCCCAAGTAGCTTATTCATACTCACGAATGAACATTAAGATGCCACGAAGCTA - >AT5G13450.2
AGTGAAGCCCAATGCACTAAGTTATTTTCTTCCTCTGACCAGTTTCATCTCTTTGCTCTCGACAAAGCAGCTGAGCGACTTTTGCACATTTCTAGGGTTCCAATCAAAATCTATCTGCAACAAAAATGGCTAATCGTTTCAGATCAGGGATCTCCTTCTTCAAGACCATCGCCGTAACAGATTCTGTCTCCTCCGTTAGATCCAAGTCGCTTTTCCCAGCGTTGAGAACTTATGCAACTGCTTCTGCTCAAACAACCGCTAATGTTAAGGTGCCTATTGCTTTAGTTGGTGAAAATGGGAACTTTGCTTCATGGCTATACATTGCAGCTGTGAAAATGAATTCCTTGGAAAAGATTGAGACGGATCTTTCTGAGATGATTGAGGCAATGAAGACAGCTCCTATTTTTGCTCAGTTTACAAAGGATCCCTCTGTTCCTAGAGGGACAAGATTGGCTGCTATTAGGGATGCTTGTGATCAAGCAAAGTTTGCCGAACCCACTAAGAACTTCCTCTCTTTGTTAGCTGAGAATGGAAAGCTGAAGAACCTAGATGCCATTGTGAAGAAATTTATGCAGCTGACAAACGCACATAGGGGAGATGTCAAAGTTTTGGTTACCACAGTCATTCCGCTTCCCCCTGCTGAGGAGAAAGAACTGACTGAGACGCTTCAGGAGATCATTGGAGCAGGGAAGAAAATCACTGTGGAACAAAAGATTGATCCAAGTATCTACGGTGGACTAATCGTAGAGTTCCAACAAAAGGTGTTGGACATGTCAATCAGGACAAGGGCACAACAGATGGAGAGGCTCCTCCGTGAACCTGTTGACTTCAACAACCTCTGAAAATCTTGAGAGAAATTTCCCCCAAGAAAACATGCTTGTGATGAATGCCACCAATTGACAAATAAATATGGACCCTCCTGGGAAACAATATAATAGCTGGCCACTTCTCTCCCTTTGAATTTTGTCATTTGCTTTTTACATATTGTTGTTTGCTTCGAAATAAAGCTTTTCGAGACATCAAATTTCAATGAGATTGTTTTTGTTTAGATTTGAATCGTTGGGCTAATTTGGTAAATAAATCTACAAACTATGCCCAAGTAGCTTATTCATACTCACGAATGAACATTAAGATGCCACGAAGCTA
CDS Sequence
Protein Sequence