Information report for AT5G13420
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- GO:0009507 — located in — chloroplast
- GO:0009809 — acts upstream of or within — lignin biosynthetic process
- GO:0006098 — involved in — pentose-phosphate shunt
- GO:0004801 — enables — transaldolase activity
- GO:0009570 — located in — chloroplast stroma
- GO:0005975 — involved in — carbohydrate metabolic process
- GO:0009749 — acts upstream of or within — response to glucose
- GO:0009536 — located in — plastid
- GO:0005739 — located in — mitochondrion
- GO:0005622 — is active in — intracellular anatomical structure
- SALK_202022C — Chlorotic cotyledons as well as retarded seedling growth after 14 days grown on 1/2 MS medium containing 3% Glc; reduced transaldolase activity; Glc-induced ROS accumulation.
- SALK_206302C — Chlorotic cotyledons as well as retarded seedling growth after 14 days grown on 1/2 MS medium containing 3% Glc; reduced transaldolase activity; Glc-induced ROS accumulation.
Functional Keywords
Literature and News
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Linking protein fractionation with multidimensional monolithic reversed-phase peptide chromatography/mass spectrometry enhances protein identification from complex mixtures even in the presence of abundant proteins. DOI: 10.1002/rcm.1376 ; PMID: 15052571
- Responses of primary and secondary metabolism to sugar accumulation revealed by microarray expression analysis of the Arabidopsis mutant, pho3. DOI: 10.1093/jxb/erh143 ; PMID: 15133053
- Loss of TIP1;1 aquaporin in Arabidopsis leads to cell and plant death. DOI: 10.1111/j.1365-313X.2004.02265.x ; PMID: 15584951
- Biosynthesis of cellulose-enriched tension wood in Populus: global analysis of transcripts and metabolites identifies biochemical and developmental regulators in secondary wall biosynthesis. DOI: 10.1111/j.1365-313X.2005.02584.x ; PMID: 16367961
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- The Arabidopsis thaliana transcriptome in response to Agrobacterium tumefaciens. DOI: 10.1094/MPMI-19-0665 ; PMID: 16776300
- A putative hydroxysteroid dehydrogenase involved in regulating plant growth and development. DOI: 10.1104/pp.107.100560 ; PMID: 17616511
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- A systems biology view of responses to lignin biosynthesis perturbations in Arabidopsis. DOI: 10.1105/tpc.112.102574 ; PMID: 23012438
- Stacking of a low-lignin trait with an increased guaiacyl and 5-hydroxyguaiacyl unit trait leads to additive and synergistic effects on saccharification efficiency in Arabidopsis thaliana. DOI: 10.1186/s13068-018-1257-y ; PMID: 30250509
- GSM2, a transaldolase, contributes to reactive oxygen species homeostasis in Arabidopsis. DOI: 10.1007/s11103-020-01022-x ; PMID: 32564178
- CONSTITUTIVE EXPRESSER OF PATHOGENESIS-RELATED GENES 5 is an RNA-binding protein controlling plant immunity via an RNA processing complex. DOI: 10.1093/plcell/koac037 ; PMID: 35137215
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
- Analysis of the Arabidopsis cytosolic proteome highlights subcellular partitioning of central plant metabolism. DOI: 10.1021/pr1009433 ; PMID: 21166475
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
- GSM2, a transaldolase, contributes to reactive oxygen species homeostasis in Arabidopsis. DOI: 10.1007/s11103-020-01022-x ; PMID: 32564178
Gene Resources
- UniProt: Q9LYR4
- EMBL: AL163572, AY056296, AY087135
- AlphaFoldDB: Q9LYR4
- EnsemblPlants: AT5G13420.1
- Gramene: AT5G13420.1
- KEGG: ath:AT5G13420
- Orthologous matrix: ATECYYQ
- ExpressionAtlas: AT5G13420
Sequences
cDNA Sequence
- >AT5G13420.1
CTCAAAACTTCACCAACCCCATTTTTAAGCCCCTTTCTTTGTTTTTATCCTCCGATCGATCAAACCAAGAAAAAACACTTTCGTATTTCCCTCGACGAAAAAAATGGCAACCATTTCGAATCTCGCTAATCTTCCCCGCGCCACCTGCGTCGACTCCAAATCTTCTTCCTCTTCCTCCGTCTTACCTAGATCCTTCGTCAATTTCCGCGCTTTGAATGCAAAGCTTTCCTCTTCTCAGCTTTCTCTTCGTTATAACCAACGATCAATACCTTCCCTCTCTGTGAGGTGTTCAGTGTCTGGTGGAAATGGAACTGCTGGAAAGAGAACGACTCTTCATGATCTATATGAGAAGGAAGGTCAGAGTCCTTGGTATGATAATCTTTGCCGTCCAGTCACAGATCTTCTCCCGTTGATTGCTCGTGGTGTTAGAGGTGTTACTAGCAACCCTGCGATCTTCCAAAAAGCCATTTCCACTTCAAATGCTTATAATGATCAATTCAGGACACTTGTGGAATCGGGAAAGGACATTGAAAGTGCGTATTGGGAACTTGTGGTGAAGGATATTCAGGATGCCTGCAAACTTTTTGAGCCAATCTATGACCAGACAGAAGGTGCGGATGGCTATGTCTCTGTTGAAGTTTCACCTAGGCTTGCTGATGATACCCAAGGAACTGTTGAAGCTGCTAAATATCTTAGCAAGGTTGTCAACCGTCGTAATGTCTACATTAAGATTCCTGCTACTGCTCCATGCATTCCTTCCATCAGGGATGTCATTGCAGCTGGAATAAGTGTCAATGTCACGCTTATATTCTCAATCGCCAGATATGAAGCAGTGATCGATGCATATTTGGATGGCCTCGAGGCGTCTGGACTTGATGACCTCTCAAGAGTTACCAGTGTTGCTTCCTTCTTTGTCAGTCGGGTGGATACTCTCATGGACAAGATGCTTGAGCAAATTGGTACCCCTGAAGCCTTAGATCTCCGTGGGAAGGCGGCTGTGGCTCAAGCTGCATTAGCATACAAGCTATACCAGCAGAAATTCTCTGGCCCAAGATGGGAAGCTCTGGTAAAGAAAGGTGCCAAGAAACAGAGACTTCTCTGGGCATCAACAAGTGTAAAGAACCCAGCTTACTCTGACACCTTATATGTCGCTCCTCTCATCGGACCTGACACTGTATCAACCATGCCGGATCAAGCCCTGGAAGCATTCGCAGATCATGGAATAGTGAAGAGGACAATAGATGCGAATGTGTCAGAAGCAGAAGGGATTTACAGTGCACTAGAGAAGCTGGGAATAGACTGGAACAAAGTAGGAGAACAGTTGGAAGACGAAGGAGTAGATTCCTTCAAGAAGAGTTTCGAGAGTCTGCTCGGTACACTGCAAGACAAGGCCAACACTCTCAAACTAGCCAGCCATTGAGGAAATGAGTCATCATTATGTTTTTGGTTACGCTAAAATAAAAAGAAGAACCTTTGGCTTTTGTTCTTCAATCCTTATGCATGCTTTCTAAAGTGGTTATGATGGATTTTGCTTGATGTTCCACATTATGGGTTATTCTATTTTCTTTGTTCTTGTAAGATGATGCTTCAGAAGAGTTTGTTACTTTTTACCGTATTTGTAATTTACATTTTCACTGAAAACAATTGGCGAGTAAAAAAGTGTCCTTGTCTTCTTCTTTGTTCGGATTATATGAACAATTGTTCCTAG
CDS Sequence
Protein Sequence