Information report for AT5G13080
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0025034 — leaf — hoja (Spanish, exact), 葉 (Japanese, exact)
- GO:0032107 — acts upstream of or within — regulation of response to nutrient levels
- GO:0000122 — acts upstream of or within — negative regulation of transcription by RNA polymerase II
- GO:0048527 — acts upstream of or within — lateral root development
- GO:0000978 — enables — RNA polymerase II cis-regulatory region sequence-specific DNA binding
- GO:0005634 — located in — nucleus
- GO:0043620 — acts upstream of or within — regulation of DNA-templated transcription in response to stress
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0010055 — acts upstream of or within — atrichoblast differentiation
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0005515 — enables — protein binding
Literature and News
- The WRKY superfamily of plant transcription factors. DOI: 10.1016/s1360-1385(00)01600-9 ; PMID: 10785665
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The response regulator 2 mediates ethylene signalling and hormone signal integration in Arabidopsis. DOI: 10.1038/sj.emboj.7600337 ; PMID: 15282545
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- Immunopurification of polyribosomal complexes of Arabidopsis for global analysis of gene expression. DOI: 10.1104/pp.105.059477 ; PMID: 15955926
- Genome-wide analysis of transcript abundance and translation in Arabidopsis seedlings subjected to oxygen deprivation. DOI: 10.1093/aob/mci217 ; PMID: 16081496
- Genome-wide analysis of hydrogen peroxide-regulated gene expression in Arabidopsis reveals a high light-induced transcriptional cluster involved in anthocyanin biosynthesis. DOI: 10.1104/pp.105.065896 ; PMID: 16183842
- Potato homologs of Arabidopsis thaliana genes functional in defense signaling–identification, genetic mapping, and molecular cloning. DOI: 10.1094/MPMI-18-1107 ; PMID: 16255250
- Genome-wide transcriptional analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human pathogen Escherichia coli O157:H7. DOI: 10.1111/j.1365-313X.2006.02725.x ; PMID: 16553894
- Type III effectors orchestrate a complex interplay between transcriptional networks to modify basal defence responses during pathogenesis and resistance. DOI: 10.1111/j.1365-313X.2006.02672.x ; PMID: 16553893
- Transcriptional changes in powdery mildew infected wheat and Arabidopsis leaves undergoing syringolin-triggered hypersensitive cell death at infection sites. DOI: 10.1007/s11103-006-9045-7 ; PMID: 16941219
- Gene expression profiles of O3-treated Arabidopsis plants. DOI: 10.1111/j.1365-3040.2006.01542.x ; PMID: 16913859
- Temporal responses of transcripts, enzyme activities and metabolites after adding sucrose to carbon-deprived Arabidopsis seedlings. DOI: 10.1111/j.1365-313X.2006.02979.x ; PMID: 17217462
- Analysis of gene expression profiles in response to Sclerotinia sclerotiorum in Brassica napus. DOI: 10.1007/s00425-007-0586-z ; PMID: 17665211
- Dual regulation role of GH3.5 in salicylic acid and auxin signaling during Arabidopsis-Pseudomonas syringae interaction. DOI: 10.1104/pp.107.106021 ; PMID: 17704230
- Genome-wide interacting effects of sucrose and herbicide-mediated stress in Arabidopsis thaliana: novel insights into atrazine toxicity and sucrose-induced tolerance. DOI: 10.1186/1471-2164-8-450 ; PMID: 18053238
- Global transcript levels respond to small changes of the carbon status during progressive exhaustion of carbohydrates in Arabidopsis rosettes. DOI: 10.1104/pp.107.115592 ; PMID: 18305208
- A comparison of leaf and petal senescence in wallflower reveals common and distinct patterns of gene expression and physiology. DOI: 10.1104/pp.108.120402 ; PMID: 18539778
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Overexpression of OsWRKY72 gene interferes in the abscisic acid signal and auxin transport pathway of Arabidopsis. DOI: 10.1007/s12038-010-0051-1 ; PMID: 20826955
- DPI-ELISA: a fast and versatile method to specify the binding of plant transcription factors to DNA in vitro. DOI: 10.1186/1746-4811-6-25 ; PMID: 21108821
- A subcellular localization compendium of hydrogen peroxide-induced proteins. DOI: 10.1111/j.1365-3040.2011.02323.x ; PMID: 21443605
- AtWRKY40 and AtWRKY63 modulate the expression of stress-responsive nuclear genes encoding mitochondrial and chloroplast proteins. DOI: 10.1104/pp.113.215996 ; PMID: 23509177
- A regulatory cascade involving class II ETHYLENE RESPONSE FACTOR transcriptional repressors operates in the progression of leaf senescence. DOI: 10.1104/pp.113.218115 ; PMID: 23629833
- Transcriptional dynamics of two seed compartments with opposing roles in Arabidopsis seed germination. DOI: 10.1104/pp.113.223511 ; PMID: 23858430
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- Non-cell-autonomous regulation of root hair patterning genes by WRKY75 in Arabidopsis. DOI: 10.1104/pp.113.233775 ; PMID: 24676857
- Arabidopsis MYC Transcription Factors Are the Target of Hormonal Salicylic Acid/Jasmonic Acid Cross Talk in Response to Pieris brassicae Egg Extract. DOI: 10.1104/pp.16.00031 ; PMID: 26884488
- Acclimation of the crucifer Eutrema salsugineum to phosphate limitation is associated with constitutively high expression of phosphate-starvation genes. DOI: 10.1111/pce.12750 ; PMID: 27038434
- The Arabidopsis Mitochondrial Protease FtSH4 Is Involved in Leaf Senescence via Regulation of WRKY-Dependent Salicylic Acid Accumulation and Signaling. DOI: 10.1104/pp.16.00008 ; PMID: 28250067
- BOTRYTIS-INDUCED KINASE1, a plasma membrane-localized receptor-like protein kinase, is a negative regulator of phosphate homeostasis in Arabidopsis thaliana. DOI: 10.1186/s12870-016-0841-1 ; PMID: 27389008
- A Tripartite Amplification Loop Involving the Transcription Factor WRKY75, Salicylic Acid, and Reactive Oxygen Species Accelerates Leaf Senescence. DOI: 10.1105/tpc.17.00438 ; PMID: 29061866
- Transcription Factor WRKY75 Interacts with DELLA Proteins to Affect Flowering. DOI: 10.1104/pp.17.00657 ; PMID: 29133369
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- The transcription factor WRKY75 positively regulates jasmonate-mediated plant defense to necrotrophic fungal pathogens. DOI: 10.1093/jxb/eraa529 ; PMID: 33165597
- Arabidopsis SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2 inhibit WRKY75 function in abscisic acid-mediated leaf senescence and seed germination. DOI: 10.1093/jxb/erab391 ; PMID: 34435636
- ATL8, a RING E3 ligase, modulates root growth and phosphate homeostasis in Arabidopsis. DOI: 10.1016/j.plaphy.2022.03.019 ; PMID: 35325659
- Ethylene Plays a Dual Role during Infection by Plasmodiophora brassicae of Arabidopsis thaliana. DOI: 10.3390/genes13081299 ; PMID: 35893035
- CycC1;1-WRKY75 complex-mediated transcriptional regulation of SOS1 controls salt stress tolerance in Arabidopsis. DOI: 10.1093/plcell/koad105 ; PMID: 37040621
- Correction to: CycC1;1-WRKY75 complex-mediated transcriptional regulation of SOS1 controls salt stress tolerance in Arabidopsis. DOI: 10.1093/plcell/koad161 ; PMID: 37314884
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
Gene Resources
- UniProt: A0A178UJF4
- EMBL: CACRSJ010000110, CACSHJ010000096, LR881470
- AlphaFoldDB: A0A178UJF4
- EnsemblPlants: AT5G13080.1
- Gramene: AT5G13080.1
- KEGG: ath:AT5G13080
- Orthologous matrix: AFHTRSH
- ExpressionAtlas: AT5G13080
- InterPro: IPR003657, IPR036576, IPR044810
- PANTHER: PTHR31221, PTHR31221:SF83
- SUPFAM: SSF118290
- PROSITE: PS50811
- Gene3D: 2.20.25.80
- OrthoDB: A0A178UJF4
- SWISS-MODEL: A0A178UJF4
Sequences
cDNA Sequence
- >AT5G13080.1
GTCTACCATAAATATGTCTATATATTTTAGACTAAACTTTATTATGTTTTCACAAAGATATCTTAACAAACTCCAATCAATTATCAAACAAAAAGAGAGGAACAAAATTCTTCTTCTTTTGGAATTCAGGTGGATCGGTCTGTCTCGTTGTTATAATCAAGATTCCACAAATAATTAGGAATATGGAGGGATATGATAATGGGTCGTTGTATGCTCCTTTTTTGTCGTTGAAATCTCATTCGAAACCAGAGCTGCATCAAGGCGAAGAAGAGAGCTCAAAGGTTAGATCAGAAGGTTGTTCGAAAAGCGTGGAGTCGTCGAAAAAGAAGGGGAAGAAACAAAGGTATGCGTTTCAAACAAGGAGCCAAGTGGATATTCTTGATGATGGTTATCGATGGAGGAAATATGGCCAAAAGGCCGTCAAGAACAACAAGTTCCCTAGGAGTTACTATAGGTGTACATATGGAGGATGCAATGTGAAGAAGCAAGTGCAAAGATTAACAGTGGACCAAGAAGTGGTCGTGACAACCTACGAAGGAGTGCATTCGCATCCCATCGAGAAATCCACCGAAAACTTCGAGCATATTCTCACTCAAATGCAAATCTACTCTTCTTTCTAGTTAATTCTCTCAAAATCTTTTATACCTTATTTTAGAGCCTATAATTCTTAGAGCTCATGTTGTAAATTATTTACAAAAATTAGAATGTTACATTTTACGTGTGTTGAAAAGAAAAACCATGCATGATCTGATGATCAGCTGAAGTTTGTATCCTAATAATTTTTAATAAAAATTTCAAAAATTGAGTGTA
CDS Sequence
Protein Sequence