Gene Details:
- Gene ID: AT5G12870
- Gene Symbol: ATMYB46, MYB46
- Gene Name: MYB DOMAIN PROTEIN 46, myb domain protein 46
- Description: myb domain protein 46;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000272 — protoxylem — portion of protoxylem tissue (exact), protoxilema (Spanish, exact), 原生木(質)部 (Japanese, exact)
- PO:0000372 — metaxylem — metaxilema (Spanish, exact), portion of metaxylem tissue (exact), 後生木部 (Japanese, exact)
- PO:0003015 — primary root differentiation zone — zona de diferenciación de la raíz primary (Spanish, exact), 一次根分化帯(層) (Japanese, exact)
- PO:0025257 — primary root elongation zone — zona de elongación de la raíz primaria (Spanish, exact), 一次根伸長帯(層) (Japanese, exact)
Function-related keywords:
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The R2R3-MYB gene family in Arabidopsis thaliana. DOI: 10.1016/s1369-5266(00)00199-0 ; PMID: 11597504
- The xylem and phloem transcriptomes from secondary tissues of the Arabidopsis root-hypocotyl. DOI: 10.1104/pp.105.060202 ; PMID: 15923329
- The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. DOI: 10.1007/s11103-005-2910-y ; PMID: 16463103
- Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots. DOI: 10.1073/pnas.0510607103 ; PMID: 16581911
- Quantification of transcription factor expression from Arabidopsis images. DOI: 10.1093/bioinformatics/btl228 ; PMID: 16873489
- A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis. DOI: 10.1105/tpc.108.061325 ; PMID: 18952777
- MYB58 and MYB63 are transcriptional activators of the lignin biosynthetic pathway during secondary cell wall formation in Arabidopsis. DOI: 10.1105/tpc.108.063321 ; PMID: 19122102
- Gibberellin acts through jasmonate to control the expression of MYB21, MYB24, and MYB57 to promote stamen filament growth in Arabidopsis. DOI: 10.1371/journal.pgen.1000440 ; PMID: 19325888
- Ectopic expression of MYB46 identifies transcriptional regulatory genes involved in secondary wall biosynthesis in Arabidopsis. DOI: 10.1111/j.1365-313X.2009.03989.x ; PMID: 19674407
- Transcriptional regulation of lignin biosynthesis. DOI: 10.4161/psb.4.11.9875 ; PMID: 19838072
- MYB83 is a direct target of SND1 and acts redundantly with MYB46 in the regulation of secondary cell wall biosynthesis in Arabidopsis. DOI: 10.1093/pcp/pcp139 ; PMID: 19808805
- Transcriptional activation of secondary wall biosynthesis by rice and maize NAC and MYB transcription factors. DOI: 10.1093/pcp/pcr123 ; PMID: 21908441
- MYB46 and MYB83 bind to the SMRE sites and directly activate a suite of transcription factors and secondary wall biosynthetic genes. DOI: 10.1093/pcp/pcr185 ; PMID: 22197883
- The heterologous expression in Arabidopsis thaliana of sorghum transcription factor SbbHLH1 downregulates lignin synthesis. DOI: 10.1093/jxb/ert150 ; PMID: 23698629
- Transcription factors that directly regulate the expression of CSLA9 encoding mannan synthase in Arabidopsis thaliana. DOI: 10.1007/s11103-013-0154-9 ; PMID: 24243147
- Pinoresinol reductase 1 impacts lignin distribution during secondary cell wall biosynthesis in Arabidopsis. DOI: 10.1016/j.phytochem.2014.07.008 ; PMID: 25107662
- Promoter-based integration in plant defense regulation. DOI: 10.1104/pp.114.248716 ; PMID: 25352272
- Reconstitution of a secondary cell wall in a secondary cell wall-deficient Arabidopsis mutant. DOI: 10.1093/pcp/pcu208 ; PMID: 25535195
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- Improving total saccharification yield of Arabidopsis plants by vessel-specific complementation of caffeoyl shikimate esterase (cse) mutants. DOI: 10.1186/s13068-016-0551-9 ; PMID: 27390589
- Expression analysis of transporter genes for screening candidate monolignol transporters using Arabidopsis thaliana cell suspensions during tracheary element differentiation. DOI: 10.1007/s10265-017-0979-4 ; PMID: 28921082
- The Receptor-Like Kinase AtVRLK1 Regulates Secondary Cell Wall Thickening. DOI: 10.1104/pp.17.01279 ; PMID: 29678858
- Dual role of SND1 facilitates efficient communication between abiotic stress signalling and normal growth in Arabidopsis. DOI: 10.1038/s41598-018-28413-x ; PMID: 29973639
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- Arabidopsis C-terminal binding protein ANGUSTIFOLIA modulates transcriptional co-regulation of MYB46 and WRKY33. DOI: 10.1111/nph.16826 ; PMID: 32706429
- Mitogen-activated protein kinase 6 negatively regulates secondary wall biosynthesis by modulating MYB46 protein stability in Arabidopsis thaliana. DOI: 10.1371/journal.pgen.1009510 ; PMID: 33826618
- Understanding the Modus Operandi of Class II KNOX Transcription Factors in Secondary Cell Wall Biosynthesis. DOI: 10.3390/plants11040493 ; PMID: 35214825
- Arabidopsis GELP7 functions as a plasma membrane-localized acetyl xylan esterase, and its overexpression improves saccharification efficiency. DOI: 10.1007/s11103-022-01275-8 ; PMID: 35577991
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. DOI: 10.1007/s11103-005-2910-y ; PMID: 16463103
- Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots. DOI: 10.1073/pnas.0510607103 ; PMID: 16581911
- The MYB46 transcription factor is a direct target of SND1 and regulates secondary wall biosynthesis in Arabidopsis. DOI: 10.1105/tpc.107.053678 ; PMID: 17890373
Sequences:
cDNA Sequence
- >AT5G12870.1
CATCATTCTCCCTTCATCAAGTCTTCTCTCTTTTCTCTCTCTATTATAAAACAAACTTCACTCGTTCACATCAATGGATCCTTGAGAAAGACAAACAAATTGAAGAGAAATAATAACAATTAACTCAACCAAAAATATGAGGAAGCCAGAGGTAGCCATTGCAGCTAGTACTCACCAAGTAAAGAAGATGAAGAAGGGACTTTGGTCTCCTGAGGAAGACTCAAAGCTGATGCAATACATGTTAAGCAATGGACAAGGATGTTGGAGTGATGTTGCGAAAAACGCAGGACTTCAAAGATGTGGCAAAAGCTGCCGTCTTCGTTGGATCAACTATCTTCGTCCTGACCTCAAGCGTGGCGCTTTCTCTCCTCAAGAAGAGGATCTCATCATTCGCTTTCATTCCATCCTCGGCAACAGGTGGTCTCAGATTGCAGCACGATTGCCTGGTCGGACCGATAACGAGATCAAGAATTTCTGGAACTCAACAATAAAGAAAAGGCTAAAGAAGATGTCCGATACCTCCAACTTAATCAACAACTCATCCTCATCACCCAACACAGCAAGCGATTCCTCTTCTAATTCCGCATCTTCTTTGGATATTAAAGACATTATAGGAAGCTTCATGTCCTTACAAGAACAAGGCTTCGTCAACCCTTCCTTGACCCACATACAAACCAACAATCCATTTCCAACGGGAAACATGATCAGCCACCCGTGCAATGACGATTTTACCCCTTATGTAGATGGTATCTATGGAGTAAACGCAGGGGTACAAGGGGAACTCTACTTCCCACCTTTGGAATGTGAAGAAGGTGATTGGTACAATGCAAATATAAACAACCACTTAGACGAGTTGAACACTAATGGATCCGGAAACGCACCTGAGGGTATGAGACCAGTGGAAGAATTTTGGGACCTTGACCAGTTGATGAACACTGAGGTTCCTTCGTTTTACTTCAACTTCAAACAAAGCATATGAATATTTTTACGTCATCTTATTCTTTTTTCTATTGCGGTTTATACTCAAGATTCTTAGCCACACACACATAAATGCAAATATATATACATTGTTAGAGAGTATTTTGTATTTCGAATAATCTTTTCGTACTAGGGCTTGAGCCTTGAGGTGCCATGTAATGATTAGTCAATGTAAAACATATATCCTATAATAAATAAATAAAAGAAATAATAAGCACATACATTCTTTAATATAACAGGGGCAAACACTTGAAGAATTTTGTAATCAAGTAGC
CDS Sequence
Protein Sequence