Information report for AT5G12250
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- GO:0007017 — acts upstream of or within — microtubule-based process
- GO:0005525 — enables — GTP binding
- GO:0003924 — enables — GTPase activity
- GO:0000278 — involved in — mitotic cell cycle
- GO:0009409 — acts upstream of or within — response to cold
- GO:0003729 — enables — mRNA binding
- GO:0005200 — enables — structural constituent of cytoskeleton
- GO:0005874 — is active in — microtubule
- GO:0000226 — involved in — microtubule cytoskeleton organization
- GO:0009536 — located in — plastid
- GO:0005737 — is active in — cytoplasm
- GO:0015630 — located in — microtubule cytoskeleton
- GO:0005737 — located in — cytoplasm
Functional Keywords
- root , vascular leaf , flower , root , guard cell
Literature and News
- The small genome of Arabidopsis contains at least nine expressed beta-tubulin genes. DOI: 10.1105/tpc.4.5.549 ; PMID: 1498609
- Alteration of [beta]-Tubulin Gene Expression during Low-Temperature Exposure in Leaves of Arabidopsis thaliana. DOI: 10.1104/pp.103.2.371 ; PMID: 12231943
- Transcriptional profiling of Arabidopsis tissues reveals the unique characteristics of the pollen transcriptome. DOI: 10.1104/pp.103.028241 ; PMID: 14500793
- Transcriptional regulation of secondary growth in Arabidopsis thaliana. DOI: 10.1093/jxb/erg304 ; PMID: 14585825
- Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: and shoot-specific genes. DOI: 10.1111/j.1365-313X.2004.02051.x ; PMID: 15078338
- and copper-treated seedlings. DOI: 10.1074/jbc.M402807200 ; PMID: 15069083
- Variation in expression and protein localization of the PIN family of auxin efflux facilitator proteins in flavonoid mutants with altered auxin transport in Arabidopsis thaliana. DOI: 10.1105/tpc.021501 ; PMID: 15208397
- Induction of resistance to Verticillium dahliae in Arabidopsis thaliana by the biocontrol agent K-165 and pathogenesis-related proteins gene expression. DOI: 10.1094/MPMI-18-0555 ; PMID: 15986925
- Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. DOI: 10.1104/pp.105.063743 ; PMID: 16166256
- Cellular efflux of auxin catalyzed by the Arabidopsis MDR/PGP transporter AtPGP1. DOI: 10.1111/j.1365-313X.2005.02519.x ; PMID: 16212599
- PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin transport in Arabidopsis thaliana roots. DOI: 10.1105/tpc.105.035816 ; PMID: 16243904
- Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seed germination and floral development in Arabidopsis. DOI: 10.1104/pp.106.082289 ; PMID: 16920880
- Abscisic acid antagonizes ethylene-induced hyponastic growth in Arabidopsis. DOI: 10.1104/pp.106.092700 ; PMID: 17158582
- Examining the specific contributions of individual Arabidopsis metallothioneins to copper distribution and metal tolerance. DOI: 10.1104/pp.108.115782 ; PMID: 18287486
- GeneCAT–novel webtools that combine BLAST and co-expression analyses. DOI: 10.1093/nar/gkn292 ; PMID: 18480120
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- Modification of growth anisotropy and cortical microtubule dynamics in Arabidopsis hypocotyls grown under microgravity conditions in space. DOI: 10.1111/ppl.12640 ; PMID: 28862767
- The subfamily II catalytic subunits of protein phosphatase 2A (PP2A) are involved in cortical microtubule organization. DOI: 10.1007/s00425-018-3000-0 ; PMID: 30191298
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Comparative proteomic analysis of NaCl stress-responsive proteins in Arabidopsis roots. DOI: 10.1093/jxb/erm207 ; PMID: 17916636
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A178UPR2
- EMBL: CACRSJ010000110, CACSHJ010000096, LR881470
- AlphaFoldDB: A0A178UPR2
- EnsemblPlants: AT5G12250.1
- Gramene: AT5G12250.1
- KEGG: ath:AT5G12250
- Orthologous matrix: MANTTKY
- ExpressionAtlas: AT5G12250
- InterPro: IPR000217, IPR002453, IPR003008
- PANTHER: PTHR11588
- SUPFAM: SSF52490, SSF55307
- PROSITE: PS00227, PS00228
- Gene3D: 1.10.287.600, 3.30.1330.20, 3.40.50.1440
- OrthoDB: A0A178UPR2
- SWISS-MODEL: A0A178UPR2
- Conserved Domain Database: cd02187
Sequences
cDNA Sequence
- >AT5G12250.1
CTCCCACATCTTACCCAACGCCATCCTCAACGTTGATATCTCACCATCCAACGGCATCCAGCTTCCGATAGATTAAACCAATCACAGCCGTTGGATCAAATTTTACCTTTCCCTCTTCTTACTCTTTCATAAATAAATCCAACTTCTTCACTCTCCACCCGTCTCACTTCCTCTCCTACTCCGGTCGACGATTATCCCAATCTCGCCGGGATTCTCCTCTGCACCATAAAATAGAAGATGAGAGAAATCCTTCACATTCAAGGTGGTCAATGTGGGAACCAGATTGGTTCCAAGTTCTGGGAAGTTGTATGTGATGAGCATGGTATTGATCCCACTGGTCGTTACGTTGGAAACTCTGATCTGCAGTTGGAGCGTGTCAATGTTTACTATAACGAGGCATCCTGCGGAAGATATGTTCCCCGTGCAATTCTCATGGATCTTGAGCCTGGTACTATGGACAGTGTCAGAACTGGACCTTATGGTCAAATCTTCAGGCCTGACAACTTTGTTTTCGGGCAATCTGGTGCTGGAAACAACTGGGCTAAAGGGCATTACACTGAAGGAGCTGAGCTTATTGATGCTGTACTCGATGTTGTACGCAAAGAGGCTGAGAATTGCGACTGTCTTCAAGGTTTCCAAGTATGTCACTCACTTGGTGGAGGCACCGGGTCTGGAATGGGAACTCTGCTCATATCTAAGATCAGGGAAGAGTATCCTGATAGAATGATGCTTACATTTTCTGTCTTCCCATCACCAAAGGTCTCTGACACAGTGGTTGAGCCATACAATGCGACACTTTCAGTTCATCAGCTGGTGGAAAATGCTGATGAGTGTATGGTTTTGGACAATGAAGCCCTTTACGACATCTGTTTTAGAACACTTAAGCTTACCACTCCTAGCTTTGGTGATCTGAATCATCTTATCTCTGCAACCATGAGTGGAGTTACATGCTGTCTTAGGTTCCCGGGTCAGCTCAACTCTGATCTGAGGAAGCTCGCAGTGAACCTCATTCCTTTCCCTCGTCTCCACTTTTTCATGGTTGGTTTTGCCCCTCTCACCTCCCGTGGGTCTCAGCAGTACCGTGCACTCACTGTCCCTGAGCTGACCCAACAGATGTGGGATTCAAAGAACATGATGTGCGCAGCAGACCCGCGCCACGGGCGGTACCTAACTGCCTCGGCCATGTTCCGTGGCAAGATGAGCACAAAAGAAGTGGACGAGCAGATGATAAACGTACAGAACAAAAACTCTTCCTACTTTGTGGAATGGATTCCAAACAACGTGAAGTCAAGCGTCTGTGACATAGCTCCCCGAGGTCTCTCAATGGCATCGACATTTATTGGGAATTCCACATCGATCCAAGAGATGTTTAGGCGGGTGAGCGAGCAGTTCACTGCTATGTTCAGGAGGAAAGCTTTCTTGCATTGGTACACAGGTGAAGGAATGGACGAGATGGAGTTTACTGAAGCTGAGAGCAACATGAACGATCTAGTCTCAGAGTACCAGCAATACCAAGACGCAACTGCAGATGACGAAGGCGAGTATGAAGAAGACGAGGATGAAGAAGAGATATTGGATCATGAGTGAGTGAAAAGAGCTGATATTACCGATTTTTAAATACCTCTCTTATCTTCTTTTCGTTTGGTCGGTATATGTTTATTGAGTTTCATGTATTGTTTGTGATGGTCTGTGTGTAATAGTGAGGTCGGATCTAAACTTTTATGCGTGGTTTTTATATGAAATTGTCCATTGTGGTTTTTTATGCTCTTCCTACTTCAATTAATTGGTTTCACAATTTTACAATGTTGGTTTTTTTGACTGTCGCGGAACCAAGTTATCAATTTAAGGACGCGTGATTTTCATAATCACCATTTTTGGATTCCCAATTTCCCATAGGCCATAACCATAGACCATAATATACAATACGTAGTTTGTTCTAGTCTAAAATCAGATTAAAACTAAAAAG
CDS Sequence
Protein Sequence