Gene Details:
- Gene ID: AT5G12030
- Gene Symbol: AT-HSP17.6A, HSP17.6, HSP17.6A
- Gene Name: heat shock protein 17.6A, HEAT SHOCK PROTEIN 17.6, heat shock protein 17.6A
- Description: heat shock protein 17.6A;(source:Araport11)
- TAIR Accession: locus:2143024
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Gene Ontology:
- GO:0071456 — acts upstream of or within — cellular response to hypoxia
- GO:0006972 — acts upstream of or within — hyperosmotic response
- GO:0051259 — involved in — protein complex oligomerization
- GO:0009651 — involved in — response to salt stress
- GO:0043621 — enables — protein self-association
- GO:0042542 — involved in — response to hydrogen peroxide
- GO:0005829 — located in — cytosol
- GO:0006457 — involved in — protein folding
- GO:0005737 — located in — cytoplasm
- GO:0051082 — enables — unfolded protein binding
- GO:0006457 — acts upstream of or within — protein folding
- GO:0009408 — involved in — response to heat
Function-related keywords:
Literature:
- The expression of small heat shock proteins in seeds responds to discrete developmental signals and suggests a general protective role in desiccation tolerance. DOI: 10.1104/pp.122.4.1099 ; PMID: 10759505
- Characterization of two genes encoding small heat-shock proteins in Arabidopsis thaliana. DOI: 10.1007/BF00259608 ; PMID: 2482931
- Heat stress-induced H(2)O (2) is required for effective expression of heat shock genes in Arabidopsis. DOI: 10.1007/s11103-006-0045-4 ; PMID: 16897488
- Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. DOI: 10.1111/j.1365-313X.2006.02889.x ; PMID: 17059409
- Nuclear-mitochondrial cross-talk during heat shock in Arabidopsis cell culture. DOI: 10.1111/j.1365-313X.2007.03275.x ; PMID: 17883376
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- The polyamine spermine protects Arabidopsis from heat stress-induced damage by increasing expression of heat shock-related genes. DOI: 10.1007/s11248-012-9666-3 ; PMID: 23080295
- Spaceflight engages heat shock protein and other molecular chaperone genes in tissue culture cells of Arabidopsis thaliana. DOI: 10.3732/ajb.1200343 ; PMID: 23258370
- The heat shock factor A4A confers salt tolerance and is regulated by oxidative stress and the mitogen-activated protein kinases MPK3 and MPK6. DOI: 10.1104/pp.114.237891 ; PMID: 24676858
- Arabidopsis miR156 Regulates Tolerance to Recurring Environmental Stress through SPL Transcription Factors. DOI: 10.1105/tpc.114.123851 ; PMID: 24769482
- MicroRNA160 Modulates Plant Development and Heat Shock Protein Gene Expression to Mediate Heat Tolerance in Arabidopsis. DOI: 10.3389/fpls.2018.00068 ; PMID: 29449855
- The AtHSP17.4C1 Gene Expression Is Mediated by Diverse Signals that Link Biotic and Abiotic Stress Factors with ROS and Can Be a Useful Molecular Marker for Oxidative Stress. DOI: 10.3390/ijms20133201 ; PMID: 31261879
- Integrative Analysis from the Epigenome to Translatome Uncovers Patterns of Dominant Nuclear Regulation during Transient Stress. DOI: 10.1105/tpc.19.00463 ; PMID: 31519798
- Humic acid enhances heat stress tolerance via transcriptional activation of Heat-Shock Proteins in Arabidopsis. DOI: 10.1038/s41598-020-71701-8 ; PMID: 32929162
- HSFA1d regulates the kinetics of heat-induced HSP17.6 expression in Arabidopsis. DOI: 10.17912/micropub.biology.000555 ; PMID: 35622526
- Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. DOI: 10.1111/j.1365-313X.2006.02889.x ; PMID: 17059409
- A novel transcriptional cascade regulating expression of heat stress proteins during seed development of Arabidopsis. DOI: 10.1105/tpc.106.048165 ; PMID: 17220197
Sequences:
cDNA Sequence
- >AT5G12030.1
TTTTAAGTTCTATAACACCGAAACAATCGCTCTCTCTACATTGCTCTAGAACTATCCAACTCAACTTCTATTTAATACTTTCTTACATCAAAATCAAAATCAATCAAACCAAAGAAAAAGCCAAGAAGCAAGAAAGTTAACACAACAGCTAAGAATGGATTTGGAGTTTGGAAGGTTTCCAATATTTTCAATCCTCGAAGACATGCTTGAAGCCCCTGAAGAACAAACCGAGAAGACTCGTAACAACCCTTCAAGAGCTTACATGCGAGACGCAAAGGCAATGGCTGCTACACCAGCTGACGTTATCGAGCACCCGGATGCGTACGTTTTCGCCGTGGACATGCCTGGAATCAAAGGAGATGAGATTCAGGTCCAGATAGAGAACGAGAACGTGCTTGTGGTGAGTGGCAAAAGACAGAGGGACAACAAGGAGAATGAAGGTGTGAAGTTTGTGAGGATGGAGAGGAGGATGGGGAAGTTTATGAGGAAGTTTCAGTTACCTGATAATGCAGATTTGGAGAAGATCTCTGCGGCTTGTAATGACGGTGTGTTGAAAGTGACTATTCCGAAACTTCCTCCTCCTGAGCCAAAGAAACCAAAGACTATACAAGTTCAAGTCGCTTGAGTTTGTTTGTGATCGTGTTTTTGTGTTTTAATGAATGTAATCGATAAGCAACTACCTCTTGGTGTTCGTTGTAAAATGAAATAAAAATAGTTTTCTCTGTTCATATTTGTCTTTGTGTTCAATCTTCAAATCAATGAAGTTTTTGCTCTCTTGAACCATCCATGCTTATGAGGCAAAAATAGGACCACAACAAAAAAGACACCGAATGGTCATTCCTCTGTTTTTGCAGAAATTATTACTGTTCATCCTTTCCTAAT
CDS Sequence
Protein Sequence