Gene Details:
- Gene ID: AT5G11740
- Gene Symbol: AGP15, ATAGP15
- Gene Name: arabinogalactan protein 15
- Description: arabinogalactan protein 15;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Function-related keywords:
Literature:
- The classical arabinogalactan protein gene family of arabidopsis. DOI: 10.1105/tpc.12.9.1751 ; PMID: 11006345
- Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis. DOI: 10.1104/pp.010884 ; PMID: 12068095
- Using genomic resources to guide research directions. The arabinogalactan protein gene family as a test case. DOI: 10.1104/pp.003459 ; PMID: 12177459
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- Post-translational modifications of arabinogalactan-peptides of Arabidopsis thaliana. Endoplasmic reticulum and glycosylphosphatidylinositol-anchor signal cleavage sites and hydroxylation of proline. DOI: 10.1074/jbc.M407594200 ; PMID: 15322080
- Organ-specific expression of Arabidopsis genome during development. DOI: 10.1104/pp.104.054783 ; PMID: 15888681
- AtFLA11, a fasciclin-like arabinogalactan-protein, specifically localized in sclerenchyma cells. DOI: 10.1271/bbb.69.1963 ; PMID: 16244449
- Rapid transcriptome changes induced by cytosolic Ca2+ transients reveal ABRE-related sequences as Ca2+-responsive cis elements in Arabidopsis. DOI: 10.1105/tpc.106.042713 ; PMID: 16980540
- Gene expression profiling of the different stages of Arabidopsis thaliana trichome development on the single cell level. DOI: 10.1016/j.plaphy.2007.11.001 ; PMID: 18160300
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Differential expression patterns of arabinogalactan proteins in Arabidopsis thaliana reproductive tissues. DOI: 10.1093/jxb/eru300 ; PMID: 25053647
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- The classical arabinogalactan protein gene family of arabidopsis. DOI: 10.1105/tpc.12.9.1751 ; PMID: 11006345
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
Sequences:
cDNA Sequence
- >AT5G11740.1
AAAAAAATAGACAGCTCATCAAATTCTTCACGCGCCAACACAACAGACCGTTGTGCCTTTTTATCTCAGCGAGTTAGATCCACGCCCCTCGTTGAGCGTCCCAAAAAAACTCCCGAATAAATATCCTCAAACGGCGCCGTAACGGAGAAAGATGACCTGTCGAAATCTCAGTAAATACGCGGAGCAATATCAGCCGTCGATAATCAAATTCCAGCTGGAAAAACCTGGGCAACTAAACCAACTAAACCGGGCAGCTTCACATCTGCCCGACCTCTTTAAATACCCCTCACCACATTTCATGATAGAAAACCCTTAAGCTAAGCAAATTTCAAAGCATTTCAAAAACCCTAGCCTATCTCTCTTTATCTCTCACAACAAAATCTTTGAAATGGCGATCTCTAAGGCTTCCATTGTTGTTCTCATGATGGTGATTATCTCCGTCGTTGCATCGGCACAATCTGAGGCACCAGCACCAAGTCCTACTTCTGGATCTAGTGCGATCTCAGCGTCTTTCGTGTCAGCTGGAGTTGCAGCAGTCGCGGCTCTTGTTTTTGGCTCAGCTCTTCGGATCTAAGTTACTGTGATGGTGATTTCGTACAGAGATTGTTTTTGCGGTATAGGCCATTCATCATTATTCGTCGTCTCGTGTGTATTCCGAAGCAGCTTATAGATCTCATTTTCTATTTGTCCCTCTTCTTCTTCGTTTTCTATCTTAATCTTCATATCTGTATGAGGATATTACTATTTCTTTTTAGAGTATTTGTGGTTTTGTGATTTTCTAGACGATTTCTTAGTTATGCGATATGGTTTTTGATATGATATGAATCTTATTCTATTTATTTATATGGATTTCTCTTGAGATTTCTCTTTTTTCCTTATGCTAAATCATTTCTCAAGCATCTGGTTCTGCTACGATTCATAGTTCCTGGAGAATCAGAATAAATTCCAACCGATCTAAATCGAATGAATCCAACTAAAATTGAACTGTAATCCAAAAGCGAACTTTAAATTTATTCAAAACAATTATATTTGAG
CDS Sequence
Protein Sequence