AT5G11260

Information report for AT5G11260

Gene Details

Gene ID: AT5G11260
Gene Symbol: HY5, TED 5
Gene Name: ELONGATED HYPOCOTYL 5, REVERSAL OF THE DET PHENOTYPE 5
Description: Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11)
TAIR Accession: locus:2148007
Genome: Araport11_genome_release
Species: Arabidopsis thaliana

Functional Descriptions

PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)

GO:0042753 — acts upstream of or within — positive regulation of circadian rhythm

CS71 — In the hypocotyl of light-grown Arabidopsis seedlings, chloroplasts are well developed. The morphology and distribution of chloroplasts of the mutant is indistinguishable from those of wild type only at the upper part of the hypocotyl. However, a reduced number of chloroplasts, which are pale green, are observed at the middle part of the mutant. In the lower part of the hypocotyl, the number of chloroplasts is reduced in wild-type plants; however, the mutant showed only a few small and transparent plastids.
CS71 — Mutants grown on agar plates have widely spread lateral roots. Compared with that of wild-type plants, the direction of lateral root growth is nearly horizontal rather than downward, indicating alteration of the gravitropic response. The angles between the lateral roots and the orientation of gravity are larger than those of the wild type. In addition, secondary lateral roots grow and change their direction of elongation to the horizontal.
CS71 — Roots of wild-type plants turn green when grown under light conditions. The roots of wildtype plants were green, whereas those of the mutants remained white after having been cultured for 30 days under light. The chlorophyll content in roots of the wild-type plant (Ws) was 1.1 &
CS71 — The longitudinal length of epidermal cells is ~1.9 times that of the wild type.
CS71 — The mutant showed reduced secondary thickening of the hypocotyl, with a hypocotyl diameter of ~50% of that in the wild type at the same stage. The number of lignified xylem vessels and fiber elements was reduced in the hypocotyl of the mutant as well.
CS71 — slightly elongated hypocotyl, wild-type level of spectrally detectable phytochrome; elongation not inhibited by far red, only slightly inhibited by blue; pale green plant.
SALK_096651 — dramatically elongated hypocotyl under all light conditions
SALK_096651C — Decreased sensitivity to ABA induced lateral root inhibition. Increased sensitivity to osmotic and salt stress. Increased ABA tolerance.
hy5-101 — Under FRc conditions, the length mutant hypocotyls is increased compared to that of wild-type plants. Under Rc conditions, the hypocotyl length is also increased and the cotyledon area is smaller.
hy5-215 — Mutants grown on agar plates have widely spread lateral roots. Compared with that of wild-type plants, the direction of lateral root growth is nearly horizontal rather than downward, indicating alteration of the gravitropic response. The angles between the lateral roots and the orientation of gravity are larger than those of the wild type. In addition, secondary lateral roots grow and change their direction of elongation to the horizontal.
hy5-215 — The average length of hypocotyls in the mutant seedlings is &
hy5-221 — When grown under constant red light, the mutant had longer hypocotyls compared with wild type.
hy5-KS50 — At 4 DAG, the number of lateral root primordia is increased in the Wassilewskija (Ws) wild type , but the increase was two times greater in the hy5-Ks50 mutant than in Ws.
hy5-KS50 — Mutant produces significantly reduced levels of anthocyanins and is not responsive to cytokinins at all.
hy5-KS50 — Mutants grown on agar plates have widely spread lateral roots. Compared with that of wild-type plants, the direction of lateral root growth is nearly horizontal rather than downward, indicating alteration of the gravitropic response. The angles between the lateral roots and the orientation of gravity are larger than those of the wild type. In addition, secondary lateral roots grow and change their direction of elongation to the horizontal.
hy5-KS50 — Roots of wild-type plants turn green when grown under light conditions. The roots of wildtype plants were green, whereas those of the mutants remained white after having been cultured for 30 days under light. The chlorophyll content in roots of the wild-type plant (Ws) was 1.1 &
hy5-KS50 hyh — Blue-light-grown double-mutant seedlings have a longer hypocotyl than seedlings carrying the hyh or hy5 mutation alone.
hy5-KS50 hyh — Mutant produces significantly reduced levels of anthocyanins and is not responsive to cytokinins at all.
hy5-KS50 hyh — The double-mutant seedlings contains &
pif3-1 hy5-221 — Under constant red-light conditions, the hypocotyl length of the double mutant was intermediate to that of the parental single mutants.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>AT5G11260.2
GTTCGATTCTTCAGAGATCTGACGGCGGTAGCCAGAGTAATCTATTCCTTCCCAAAATGTCTCGCAATTAGATTCTTTCCAAGTTCTTCTGTAAATCCCAAGTCCCGCTCTTTTCCTCTTTATCCTTTTCACCAGCTTCGCTACTAAGACAACAAATCTTTCCCTCTCTCTCTCGCCTGATCGATCTTCAAAGAGTAAGAAAAATGCAGGAACAAGCGACTAGCTCTTTAGCTGCAAGCTCTTTACCATCAAGCAGCGAGAGGTCATCAAGCTCTGCTCCACATTTGGAGATCAAAGAAGGAATTGAAAGCGATGAGGAGATACGGCGAGTGCCGGAGTTTGGAGGAGAAGCTGTCGGAAAAGAAACTTCCGGTAGAGAATCTGGATCGGCGACCGGTCAGGAGCGGACACAGGCGACTGTCGGAGAAAGTCAAAGGAAGCGAGGGAGGACACCGGCGGAGAAAGAGAACAAGCGGCTGAAGAGGTTGTTGAGGAACAGAGTTTCAGCTCAGCAAGCAAGAGAGAGGAAAAAGGCTTACTTGAGCGAGTTGGAAAACAGAGTGAAAGACTTGGAGAACAAAAACTCTGAACTTGAAGAGCGACTCTCTACTCTTCAGAACGAGAACCAGATGCTTAGACATGTACGTTTTGTCGATCTTACTGTTGACTTAACCTGCAACGTCAATGCTTTTGCCATTTGTTTTTTGATATATCACAGTACTGGTTTATCACATTTACGAGTCTAGGATTGACCAATAATTAGTTTAGTTAGTTAAAAGGATCTAAGAAGCTAACTTAAGCTTTAGATTAATTCTCAGAAGGCATGTAGGTTCTTGAAATGGTCATTCACTCGCATATTCTCTCAAAAGATTCTGAAGAACACAACAGGAAACAAGAGAGGAGGTGGTGGTGGTTCTAATGCTGATGCAAGCCTTTGATCTCCTTCTTCTTCTTGTGTTATATTTTTGTGGATAAAATTTACAGAGAATTGTATCAATAATTATCATGTTAAAATTATATGGGATGTGAGAGCTAATATTGCAATTGTAGACCAAGTTCTCTTATTGTAGTCTTAGATTTCTCTTAATTGAAACATAATGTTGTTTTATAACAAAAATAAGCTAATTTTTGTTCTATGATATGACATTGTGACACTGTAG
>AT5G11260.1
GTTCGATTCTTCAGAGATCTGACGGCGGTAGCCAGAGTAATCTATTCCTTCCCAAAATGTCTCGCAATTAGATTCTTTCCAAGTTCTTCTGTAAATCCCAAGTCCCGCTCTTTTCCTCTTTATCCTTTTCACCAGCTTCGCTACTAAGACAACAAATCTTTCCCTCTCTCTCTCGCCTGATCGATCTTCAAAGAGTAAGAAAAATGCAGGAACAAGCGACTAGCTCTTTAGCTGCAAGCTCTTTACCATCAAGCAGCGAGAGGTCATCAAGCTCTGCTCCACATTTGGAGATCAAAGAAGGAATTGAAAGCGATGAGGAGATACGGCGAGTGCCGGAGTTTGGAGGAGAAGCTGTCGGAAAAGAAACTTCCGGTAGAGAATCTGGATCGGCGACCGGTCAGGAGCGGACACAGGCGACTGTCGGAGAAAGTCAAAGGAAGCGAGGGAGGACACCGGCGGAGAAAGAGAACAAGCGGCTGAAGAGGTTGTTGAGGAACAGAGTTTCAGCTCAGCAAGCAAGAGAGAGGAAAAAGGCTTACTTGAGCGAGTTGGAAAACAGAGTGAAAGACTTGGAGAACAAAAACTCTGAACTTGAAGAGCGACTCTCTACTCTTCAGAACGAGAACCAGATGCTTAGACATGTACGTTTTGTCGATCTTACTGTTGACTTAACCTGCAACGTCAATGCTTTTGCCATTTGTTTTTTGATATATCACAGTACTGGTTTATCACATTTACGAGTCTAGGATTGACCAATAATTAGTTTAGTTAGTTAAAAGGATCTAAGAAGCTAACTTAAGCTTTAGATTAATTCTCAGAAGGCATGTAGGTTCTTGAAATGGTCATTCACTCGCATATTCTCTCAAAAGATTCTGAAGAACACAACAGGAAACAAGAGAGGAGGTGGTGGTGGTTCTAATGCTGATGCAAGCCTTTGATCTCCTTCTTCTTCTTGTGTTATATTTTTGTGGATAAAATTTACAGAGAATTGTATCAATAATTATCATGTTAAAATTATATGGGATGTGAGAGCTAATATTGCAATTGTAGACCAAGTTCTCTTATTGTAGTCTTAGATTTCTCTTAATTGAAACATAATGTTGTTTTATAACAAAAATAAGCTAATTTTTGTTCTATGATATGACATTGTGACACTGTAG

CDS Sequence

Protein Sequence