Information report for AT5G10980
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009049 — inflorescence — inflorescencia (Spanish, exact), 花序 (Japanese, exact), Triticeae spike (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- GO:0005730 — located in — nucleolus
- GO:0030527 — enables — structural constituent of chromatin
- GO:0005515 — enables — protein binding
- GO:0046982 — enables — protein heterodimerization activity
- GO:0080111 — acts upstream of or within — DNA demethylation
- GO:0009642 — acts upstream of or within — response to light intensity
- GO:0030875 — located in — rDNA protrusion
- GO:0005886 — located in — plasma membrane
- GO:0005634 — located in — nucleus
- GO:0010468 — acts upstream of or within — regulation of gene expression
- GO:0033993 — acts upstream of or within — response to lipid
- GO:0051641 — acts upstream of or within — cellular localization
- N587850 — No visible phenotype.
Functional Keywords
- root , root , vascular leaf , flower , inflorescence , plant sperm cell
Literature and News
- a high-density colony array study (HDCA). DOI: 10.1046/j.1365-313x.2003.01847.x ; PMID: 12969430
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Analysis of the histone H3 gene family in Arabidopsis and identification of the male-gamete-specific variant AtMGH3. DOI: 10.1111/j.1365-313X.2005.02554.x ; PMID: 16262706
- A transcriptome-based characterization of habituation in plant tissue culture. DOI: 10.1104/pp.105.076059 ; PMID: 16489130
- Functional genomic analysis of CAF-1 mutants in Arabidopsis thaliana. DOI: 10.1074/jbc.M513426200 ; PMID: 16452472
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Zygotic resetting of the HISTONE 3 variant repertoire participates in epigenetic reprogramming in Arabidopsis. DOI: 10.1016/j.cub.2010.11.012 ; PMID: 21093266
- Differential association of Arabidopsis telomeres and centromeres with histone H3 variants. DOI: 10.1038/srep01202 ; PMID: 23383372
- Selective methylation of histone H3 variant H3.1 regulates heterochromatin replication. DOI: 10.1126/science.1248357 ; PMID: 24626927
- The H3 chaperone function of NASP is conserved in Arabidopsis. DOI: 10.1111/tpj.13263 ; PMID: 27402088
- Genome-wide identification, evolutionary, and expression analyses of histone H3 variants in plants. DOI: 10.1155/2015/341598 ; PMID: 25815311
- LHP1 Interacts with ATRX through Plant-Specific Domains at Specific Loci Targeted by PRC2. DOI: 10.1016/j.molp.2018.05.004 ; PMID: 29793052
- A unified phylogeny-based nomenclature for histone variants. DOI: 10.1186/1756-8935-5-7 ; PMID: 22650316
- Disruption of NAP1 genes in Arabidopsis thaliana suppresses the fas1 mutant phenotype, enhances genome stability and changes chromatin compaction. DOI: 10.1111/tpj.15145 ; PMID: 33368779
- The Histone Chaperone HIRA Is a Positive Regulator of Seed Germination. DOI: 10.3390/ijms22084031 ; PMID: 33919775
- The histone variant H3.3 promotes the active chromatin state to repress flowering in Arabidopsis. DOI: 10.1093/plphys/kiab224 ; PMID: 34618105
- Epigenetic features drastically impact CRISPR-Cas9 efficacy in plants. DOI: 10.1093/plphys/kiac285 ; PMID: 35689624
- Genome-wide analysis of long non-coding RNAs under diel light exhibits role in floral development and the circadian clock in Arabidopsis thaliana. DOI: 10.1016/j.ijbiomac.2022.09.295 ; PMID: 36257367
- Histone chaperone ASF1 mediates H3.3-H4 deposition in Arabidopsis. DOI: 10.1038/s41467-022-34648-0 ; PMID: 36379930
- Coordinated histone variant H2A.Z eviction and H3.3 deposition control plant thermomorphogenesis. DOI: 10.1111/nph.18738 ; PMID: 36647799
- Analysis of the histone H3 gene family in Arabidopsis and identification of the male-gamete-specific variant AtMGH3. DOI: 10.1111/j.1365-313X.2005.02554.x ; PMID: 16262706
Gene Resources
- UniProt: B9DGR9
- EMBL: AK317257, AK317490
- AlphaFoldDB: B9DGR9
- EnsemblPlants: AT4G40030.1, AT4G40030.3, AT4G40030.4
- Gramene: AT4G40030.1, AT4G40030.3, AT4G40030.4
- KEGG: ath:AT4G40030, ath:AT4G40040, ath:AT5G10980
- Orthologous matrix: HIFAEMA
- ExpressionAtlas: AT5G10980
Sequences
cDNA Sequence
- >AT5G10980.1
GTATTCGCTCTCATAAGTCGAATCTTGACCGTCGAAAATGTGAAGATTGGACCACTTCTGTATTTCCTAATATTAACCGACTAAAACATTCACCTATATAATCATAATCACCTTTTACTATTCCCACACAATCATCAAGAAAACAAAACTCGCTTCCTGATAATCAAATCAAAAGCTTCTCTATCAAGCTTATCGAAAAGTCACATCTTTTGGAAGAAACAATGGCTCGTACCAAGCAAACCGCTAGGAAATCCACCGGAGGTAAAGCTCCCAGGAAGCAGCTTGCCACCAAGGCGGCGAGGAAATCAGCACCAACCACCGGAGGAGTCAAGAAGCCTCACCGTTACCGTCCAGGAACCGTCGCTCTTCGTGAGATTCGTAAGTACCAGAAGAGTACTGAATTGTTGATCCGCAAGCTTCCCTTCCAGCGTCTCGTTCGGGAAATAGCTCAGGACTTCAAGACGGATCTGAGGTTTCAGAGTCACGCGGTGTTAGCTCTTCAAGAGGCGGCTGAGGCATACCTAGTTGGACTTTTCGAGGATACTAATCTCTGCGCTATTCACGCCAAGAGGGTTACGATCATGCCTAAGGACATTCAATTGGCTAGAAGAATTCGTGGAGAACGTGCTTAAGCTTTTATTTACCTAATTCAAGTTTAGATTTTTACGATGATGTATTAGTATTCTGGATTCTTGTTTCCTATCGCTCTTTTATTTGCTTACCAAGTACATGGTGTTAATTGTTGAACTTACAGCTCTTTTAAGCAAACAGTTATGAAATCTTTCCTTTCCGTTATTGGTTCTTGTTGATTTCTTTGC
CDS Sequence
Protein Sequence