Information report for AT5G10400
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009049 — inflorescence — inflorescencia (Spanish, exact), 花序 (Japanese, exact), Triticeae spike (narrow)
- GO:0005634 — located in — nucleus
- GO:0019219 — acts upstream of or within — regulation of nucleobase-containing compound metabolic process
- GO:0005886 — located in — plasma membrane
Functional Keywords
- root , root , vascular leaf , flower , inflorescence
Literature and News
- Analysis of the histone H3 gene family in Arabidopsis and identification of the male-gamete-specific variant AtMGH3. DOI: 10.1111/j.1365-313X.2005.02554.x ; PMID: 16262706
- A transcriptome-based characterization of habituation in plant tissue culture. DOI: 10.1104/pp.105.076059 ; PMID: 16489130
- Characterization of plant Aurora kinases during mitosis. DOI: 10.1007/s11103-005-3454-x ; PMID: 16028112
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Differential association of Arabidopsis telomeres and centromeres with histone H3 variants. DOI: 10.1038/srep01202 ; PMID: 23383372
- Selective methylation of histone H3 variant H3.1 regulates heterochromatin replication. DOI: 10.1126/science.1248357 ; PMID: 24626927
- The H3 chaperone function of NASP is conserved in Arabidopsis. DOI: 10.1111/tpj.13263 ; PMID: 27402088
- Genome-wide identification, evolutionary, and expression analyses of histone H3 variants in plants. DOI: 10.1155/2015/341598 ; PMID: 25815311
- Molecular basis for the methylation specificity of ATXR5 for histone H3. DOI: 10.1093/nar/gkx224 ; PMID: 28383693
- Gene modification by fast-track recombineering for cellular localization and isolation of components of plant protein complexes. DOI: 10.1111/tpj.14450 ; PMID: 31276249
- A unified phylogeny-based nomenclature for histone variants. DOI: 10.1186/1756-8935-5-7 ; PMID: 22650316
- H3.1 Eviction Marks Female Germline Precursors in Arabidopsis. DOI: 10.3390/plants9101322 ; PMID: 33036297
- Disruption of NAP1 genes in Arabidopsis thaliana suppresses the fas1 mutant phenotype, enhances genome stability and changes chromatin compaction. DOI: 10.1111/tpj.15145 ; PMID: 33368779
- H3.1K27me1 maintains transcriptional silencing and genome stability by preventing GCN5-mediated histone acetylation. DOI: 10.1093/plcell/koaa027 ; PMID: 33793815
- The Histone Chaperone HIRA Is a Positive Regulator of Seed Germination. DOI: 10.3390/ijms22084031 ; PMID: 33919775
- Epigenetic features drastically impact CRISPR-Cas9 efficacy in plants. DOI: 10.1093/plphys/kiac285 ; PMID: 35689624
- Histone chaperone ASF1 mediates H3.3-H4 deposition in Arabidopsis. DOI: 10.1038/s41467-022-34648-0 ; PMID: 36379930
- Mitotic inheritance of genetic and epigenetic information via the histone H3.1 variant. DOI: 10.1016/j.pbi.2023.102401 ; PMID: 37302254
- Analysis of the histone H3 gene family in Arabidopsis and identification of the male-gamete-specific variant AtMGH3. DOI: 10.1111/j.1365-313X.2005.02554.x ; PMID: 16262706
Gene Resources
- UniProt: Q0WRA9
- EMBL: AK227612, AK227656, AK228405
- AlphaFoldDB: Q0WRA9
- EnsemblPlants: AT1G09200.1, AT3G27360.1, AT5G10390.1
- Gramene: AT1G09200.1, AT3G27360.1, AT5G10390.1
- KEGG: ath:AT1G09200, ath:AT3G27360, ath:AT5G10390
- Orthologous matrix: ANDCAIH
- ExpressionAtlas: AT5G10400
Sequences
cDNA Sequence
- >AT5G10400.1
TTCCCATCGATCGCATTCTCACCGAATCAAATCCAAAAGAGCAAATTTACAATCTTGCGAACTCCTAAAATGGCTCGTACCAAGCAAACAGCTCGTAAATCCACCGGAGGAAAGGCACCAAGGAAGCAACTCGCGACCAAAGCTGCGAGGAAATCAGCTCCAGCCACCGGAGGAGTGAAGAAGCCACACAGATTCCGTCCAGGAACGGTGGCGTTGAGAGAAATCAGGAAGTATCAGAAGAGTACTGAGCTTTTGATCCGTAAGCTTCCGTTCCAGAGATTGGTTCGTGAGATTGCTCAAGATTTCAAGACGGATCTGAGGTTCCAGAGCAGTGCCGTCGCAGCTCTTCAGGAAGCAGCTGAGGCTTATCTTGTTGGGCTCTTTGAAGATACTAATCTCTGTGCGATTCATGCTAAGAGGGTTACGATTATGCCTAAGGATATCCAGCTTGCGAGGAGAATCAGAGGAGAGAGGGCTTAAGTGAACGAAGATGATGAAGATTAAGAAGACTAGTCGTTTAGTTATGGATTAGCTTGTTTGGTTTCAATGGATATGTAAAGCTGTCTCTTTTCGTTTTCGAGTGTTATTAGTTTTTTACTTAGATGTGTCTTCCAGATGTTCGATGAAATGCCTAAAGGAAATTTTAATCTACTGTTGTCTAATCTTTTGATTCGTTCTGTCGATCTCCATATTTCTGCCACGCTTAAGAATCGTTTATCAACGGAAGAGTTAATTTTTTGCTCGATGAAATTGTCCAAATTGATTTGCAATAGTAGCTGCTTAGGG
CDS Sequence
Protein Sequence