Information report for AT5G10390
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009049 — inflorescence — inflorescencia (Spanish, exact), 花序 (Japanese, exact), Triticeae spike (narrow)
- GO:0009059 — acts upstream of or within — macromolecule biosynthetic process
- GO:0005886 — located in — plasma membrane
- GO:0005634 — located in — nucleus
- GO:0019219 — acts upstream of or within — regulation of nucleobase-containing compound metabolic process
- GO:0009892 — acts upstream of or within — negative regulation of metabolic process
- GO:0009314 — acts upstream of or within — response to radiation
- N574285 — No visible phenotype.
Functional Keywords
- root , flower , inflorescence
Literature and News
- Arabidopsis microarrays identify conserved and differentially expressed genes involved in shoot growth and development from distantly related plant species. DOI: 10.1046/j.1365-313x.2003.01706.x ; PMID: 12662315
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Analysis of the histone H3 gene family in Arabidopsis and identification of the male-gamete-specific variant AtMGH3. DOI: 10.1111/j.1365-313X.2005.02554.x ; PMID: 16262706
- A transcriptome-based characterization of habituation in plant tissue culture. DOI: 10.1104/pp.105.076059 ; PMID: 16489130
- BOLITA, an Arabidopsis AP2/ERF-like transcription factor that affects cell expansion and proliferation/differentiation pathways. DOI: 10.1007/s11103-006-9059-1 ; PMID: 17096212
- Arabidopsis VIRE2 INTERACTING PROTEIN2 is required for Agrobacterium T-DNA integration in plants. DOI: 10.1105/tpc.106.042903 ; PMID: 17496122
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- Zygotic resetting of the HISTONE 3 variant repertoire participates in epigenetic reprogramming in Arabidopsis. DOI: 10.1016/j.cub.2010.11.012 ; PMID: 21093266
- Differential association of Arabidopsis telomeres and centromeres with histone H3 variants. DOI: 10.1038/srep01202 ; PMID: 23383372
- Selective methylation of histone H3 variant H3.1 regulates heterochromatin replication. DOI: 10.1126/science.1248357 ; PMID: 24626927
- The H3 chaperone function of NASP is conserved in Arabidopsis. DOI: 10.1111/tpj.13263 ; PMID: 27402088
- Genome-wide identification, evolutionary, and expression analyses of histone H3 variants in plants. DOI: 10.1155/2015/341598 ; PMID: 25815311
- Molecular basis for the methylation specificity of ATXR5 for histone H3. DOI: 10.1093/nar/gkx224 ; PMID: 28383693
- Gene modification by fast-track recombineering for cellular localization and isolation of components of plant protein complexes. DOI: 10.1111/tpj.14450 ; PMID: 31276249
- A unified phylogeny-based nomenclature for histone variants. DOI: 10.1186/1756-8935-5-7 ; PMID: 22650316
- H3.1 Eviction Marks Female Germline Precursors in Arabidopsis. DOI: 10.3390/plants9101322 ; PMID: 33036297
- Disruption of NAP1 genes in Arabidopsis thaliana suppresses the fas1 mutant phenotype, enhances genome stability and changes chromatin compaction. DOI: 10.1111/tpj.15145 ; PMID: 33368779
- H3.1K27me1 maintains transcriptional silencing and genome stability by preventing GCN5-mediated histone acetylation. DOI: 10.1093/plcell/koaa027 ; PMID: 33793815
- The Histone Chaperone HIRA Is a Positive Regulator of Seed Germination. DOI: 10.3390/ijms22084031 ; PMID: 33919775
- Epigenetic features drastically impact CRISPR-Cas9 efficacy in plants. DOI: 10.1093/plphys/kiac285 ; PMID: 35689624
- Histone chaperone ASF1 mediates H3.3-H4 deposition in Arabidopsis. DOI: 10.1038/s41467-022-34648-0 ; PMID: 36379930
- Mitotic inheritance of genetic and epigenetic information via the histone H3.1 variant. DOI: 10.1016/j.pbi.2023.102401 ; PMID: 37302254
- Analysis of the histone H3 gene family in Arabidopsis and identification of the male-gamete-specific variant AtMGH3. DOI: 10.1111/j.1365-313X.2005.02554.x ; PMID: 16262706
Gene Resources
- UniProt: Q0WRA9
- EMBL: AK227612, AK227656, AK228405
- AlphaFoldDB: Q0WRA9
- EnsemblPlants: AT1G09200.1, AT3G27360.1, AT5G10390.1
- Gramene: AT1G09200.1, AT3G27360.1, AT5G10390.1
- KEGG: ath:AT1G09200, ath:AT3G27360, ath:AT5G10390
- Orthologous matrix: ANDCAIH
- ExpressionAtlas: AT5G10390
Sequences
cDNA Sequence
- >AT5G10390.1
ATTTCTCTCCCCATAAAAGCAGTCCCTCTTCTGCGTTGATCTTCACTACAAAATTTCTCATTCGCATCCTCCACAAGAAGAAAATTCGATCGGTCGATTAGTCTTTGTTTGATTTCGAAATGGCTCGTACTAAGCAAACCGCGAGGAAATCCACAGGAGGCAAAGCACCAAGAAAGCAACTCGCAACCAAGGCGGCAAGGAAATCTGCTCCGGCCACCGGAGGAGTGAAGAAGCCGCATAGATTCCGTCCAGGAACTGTTGCCTTGAGAGAGATCAGGAAGTATCAGAAGAGCACTGAGCTTCTGATCCGTAAGCTTCCTTTCCAGCGTCTGGTTCGTGAGATAGCTCAGGATTTCAAGACGGATCTGAGGTTTCAGAGCAGTGCTGTTGCTGCTTTACAAGAGGCTGCTGAGGCTTACCTTGTTGGTTTGTTTGAAGACACTAATCTTTGCGCCATTCACGCTAAGAGGGTCACCATCATGCCTAAGGATATCCAGCTCGCGAGGAGAATCAGAGGAGAAAGAGCTTGAAGACTGTTGTTATGGTTTATATCTTTTGATTTAGTTCGTCAATGGAACTCTATTTCTGGATTTTGATTTGCGTTTTAGTAGTAATGGGTTCTTGTAAGTGTTGAGCTTTGGCTCGTTTTAATTTTCAGTTGTTAGGTACTTTGGTTTAGTTAGCCTTGAAGTGTTCGATGAAATACCCCAACGAAACTCTCTCCTGTTTAATAGAACTTATTTTCCTT
CDS Sequence
Protein Sequence