Information report for AT5G10380
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000025 — root tip — punta de la raíz (Spanish, exact), 根端 (Japanese, exact)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- GO:0002238 — involved in — response to molecule of fungal origin
- GO:0043068 — acts upstream of or within — positive regulation of programmed cell death
- GO:0005739 — located in — mitochondrion
- GO:0009617 — involved in — response to bacterium
- GO:0004842 — enables — ubiquitin-protein transferase activity
- GO:0012501 — involved in — programmed cell death
- GO:0005886 — located in — plasma membrane
Functional Keywords
- root , root tip , vascular leaf , cotyledon
Literature and News
- Evaluation and classification of RING-finger domains encoded by the Arabidopsis genome. DOI: 10.1186/gb-2002-3-4-research0016 ; PMID: 11983057
- Type III effectors orchestrate a complex interplay between transcriptional networks to modify basal defence responses during pathogenesis and resistance. DOI: 10.1111/j.1365-313X.2006.02672.x ; PMID: 16553893
- A comprehensive structure-function analysis of Arabidopsis SNI1 defines essential regions and transcriptional repressor activity. DOI: 10.1105/tpc.105.039677 ; PMID: 16766691
- Identification of 118 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to chitin, a plant-defense elicitor. DOI: 10.1094/MPMI-20-8-0900 ; PMID: 17722694
- Transcriptional changes in response to growth of Arabidopsis in high external calcium. DOI: 10.1016/j.febslet.2008.02.043 ; PMID: 18307990
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- RING1 E3 ligase localizes to plasma membrane lipid rafts to trigger FB1-induced programmed cell death in Arabidopsis. DOI: 10.1111/j.1365-313X.2008.03625.x ; PMID: 18643987
- The pepper E3 ubiquitin ligase RING1 gene, CaRING1, is required for cell death and the salicylic acid-dependent defense response. DOI: 10.1104/pp.111.177568 ; PMID: 21628629
- γ-Aminobutyric acid transaminase deficiency impairs central carbon metabolism and leads to cell wall defects during salt stress in Arabidopsis roots. DOI: 10.1111/pce.12033 ; PMID: 23148892
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Arabidopsis Flower and Embryo Developmental Genes are Repressed in Seedlings by Different Combinations of Polycomb Group Proteins in Association with Distinct Sets of Cis-regulatory Elements. DOI: 10.1371/journal.pgen.1005771 ; PMID: 26760036
- Arabidopsis PRC1 core component AtRING1 regulates stem cell-determining carpel development mainly through repression of class I KNOX genes. DOI: 10.1186/s12915-016-0336-4 ; PMID: 28007029
- Correction: Arabidopsis Flower and Embryo Developmental Genes are Repressed in Seedlings by Different Combinations of Polycomb Group Proteins in Association with Distinct Sets of Cis-regulatory Elements. DOI: 10.1371/journal.pgen.1006574 ; PMID: 28122004
- Repertoire of plant RING E3 ubiquitin ligases revisited: New groups counting gene families and single genes. DOI: 10.1371/journal.pone.0203442 ; PMID: 30169501
- Structural Analysis of the Arabidopsis AL2-PAL and PRC1 Complex Provides Mechanistic Insight into Active-to-Repressive Chromatin State Switch. DOI: 10.1016/j.jmb.2018.08.021 ; PMID: 30176245
- Identification of 118 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to chitin, a plant-defense elicitor. DOI: 10.1094/MPMI-20-8-0900 ; PMID: 17722694
Gene Resources
- UniProt: A0A178UBD2
- EMBL: CACRSJ010000110, LUHQ01000005
- AlphaFoldDB: A0A178UBD2
- EnsemblPlants: AT5G10380.1
- Gramene: AT5G10380.1
- KEGG: ath:AT5G10380
- Orthologous matrix: TEPPHQE
- ExpressionAtlas: AT5G10380
- InterPro: IPR001841, IPR013083, IPR044600
- PANTHER: PTHR46913, PTHR46913:SF19
- SUPFAM: SSF101447, SSF57850
- PROSITE: PS50089
- Gene3D: 3.30.40.10
- SWISS-MODEL: A0A178UBD2
- Conserved Domain Database: cd16461
Sequences
cDNA Sequence
- >AT5G10380.1
GTCTAGATTCTAACCCATTTTGTGGGTTTTAGTGTCCTATTTCTTTTTGCTTTCATCAGAAGCAAAAACTTGGAATTGTGTGTCATACCCATTTTCCCCTGTTCTTGTTCTGTTTTCTACTAGTTGTGTCTGAAAGTAAAGTCCTCTGTTTTTGCTCTGTTTATGTCGTCTCTGAACTCCTACAATGGCGTTTAATCACAGAAAAATGCTTCTTTCATGTCTACAGTTTAAAGATTTACGCTTTTGTTTCCGGCAATACCCTCCCCCGCCACCACCACCACCGCCACCGAGGGAGCTCTCTCTCCTACTCCCCACCTCGATCTGCGTCGTCGGCTCAATCATACTCTTTCTATTTCTAGTCTTCTTCCTCTACCTCCACATCACGCAACAACGGCGGATTTCAGCCGCCAGCGTAACTCCCGGTGACACAAACCAACAGGAAGATGAGGACGAAACAGAGGAGAGAGATTTCTCCGACTTTCATCACGTTTGGCAAATCCCAACCGTCGGTCTCCACCGTTCCGCGATCAACTCGATCACAGTCGTTGGATTCAAAAAGGGAGAAGGGATAATCGACGGCACAGAATGCTCTGTCTGCTTAAACGAGTTTGAAGAAGACGAGTCGCTGAGACTGTTACCAAAGTGTAGCCATGCCTTTCATCTAAATTGCATCGACACTTGGTTGCTCTCTCACAAGAACTGTCCTTTATGTCGTGCCCCTGTACTTCTTATCACTGAACCACCTCATCAAGAAACAGAGACGAATCATCAACCAGATTCTGAATCGAGCAATGACCTCCGTGGAAGACAAGACAGTTCCAGATCTAGAAGAAACCATAACATTTTTCTTCCAAGGGCACAAAGTGATTTGGCAAACTACTGTGGCTCAGGAAGAGTAGAAAACGTGAGAAGATCGTTTTCAATTGGAGGAAGCTTATCACTTTGCGATGGTATTAACAATGCTACTAGAAGTGGAAGACAGTTCTATACCAGCTTCAGTGCTAACTTGTTCTCATCATCAAGAAGAGTAAGGAACGAACAACCGATTCCACAAAACCAAATGCCATCCGTAACTGGTAACACCAGTTAATTGGTGTAACTACATTGAAGCTTAATGTAATATCTAGTGTGTTATATACAGTATCTGAAATAAATCGAAACTTTCAATGTTTCAATATT
CDS Sequence
Protein Sequence