Information report for AT5G10360
Gene Details
|
|
Functional Descriptions
- PO:0000282 — trichome — tricoma (Spanish, exact), 毛茸、糸状体、毛 (Japanese, exact), seta (related), setae (related), capilli (narrow), capillus (narrow), cilia (narrow), cilium (narrow), glochid (narrow), glochidia (narrow), glochidium (narrow), hair (narrow), lepides (narrow), lepis (narrow), non-secretory trichome (narrow), scale (narrow), squama (narrow), squamae (narrow), squamella (narrow), squamellae (narrow), squamule (narrow), barb trichome (broad), bristle (broad)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- GO:0009793 — acts upstream of or within — embryo development ending in seed dormancy
- GO:0003729 — enables — mRNA binding
- GO:0009506 — located in — plasmodesma
- GO:0022626 — located in — cytosolic ribosome
- GO:0006412 — involved in — translation
- CS24358 — embryo defective; developmental arrest of mutant embryos occurs at preglobular stage.
Functional Keywords
Literature and News
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- Differential mRNA translation contributes to gene regulation under non-stress and dehydration stress conditions in Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2004.02090.x ; PMID: 15144383
- Cell-specific protein profiling in Arabidopsis thaliana trichomes: identification of trichome-located proteins involved in sulfur metabolism and detoxification. DOI: 10.1016/j.phytochem.2004.03.026 ; PMID: 15276459
- Versatile gene-specific sequence tags for Arabidopsis functional genomics: transcript profiling and reverse genetics applications. DOI: 10.1101/gr.2544504 ; PMID: 15489341
- Proteomic characterization of evolutionarily conserved and variable proteins of Arabidopsis cytosolic ribosomes. DOI: 10.1104/pp.104.053637 ; PMID: 15734919
- Arabidopsis TARGET OF RAPAMYCIN interacts with RAPTOR, which regulates the activity of S6 kinase in response to osmotic stress signals. DOI: 10.1105/tpc.105.035931 ; PMID: 16377759
- Expression profiling of auxin-treated Arabidopsis roots: toward a molecular analysis of lateral root emergence. DOI: 10.1093/pcp/pcj043 ; PMID: 16621846
- The Arabidopsis thaliana transcriptome in response to Agrobacterium tumefaciens. DOI: 10.1094/MPMI-19-0665 ; PMID: 16776300
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night. DOI: 10.1371/journal.pone.0029307 ; PMID: 22195043
- Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying and up-regulation. DOI: 10.1093/jxb/ert227 ; PMID: 24064926
- Ribosomal protein S6, a target of rapamycin, is involved in the regulation of rRNA genes by possible epigenetic changes in Arabidopsis. DOI: 10.1074/jbc.M113.515015 ; PMID: 24302738
- Salt hypersensitive mutant 9, a nucleolar APUM23 protein, is essential for salt sensitivity in association with the ABA signaling pathway in Arabidopsis. DOI: 10.1186/s12870-018-1255-z ; PMID: 29490615
- TOR and RPS6 transmit light signals to enhance protein translation in deetiolating Arabidopsis seedlings. DOI: 10.1073/pnas.1809526115 ; PMID: 30482859
- Capturing the phosphorylation and protein interaction landscape of the plant TOR kinase. DOI: 10.1038/s41477-019-0378-z ; PMID: 30833711
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- Cell-specific protein profiling in Arabidopsis thaliana trichomes: identification of trichome-located proteins involved in sulfur metabolism and detoxification. DOI: 10.1016/j.phytochem.2004.03.026 ; PMID: 15276459
- Proteomic characterization of evolutionarily conserved and variable proteins of Arabidopsis cytosolic ribosomes. DOI: 10.1104/pp.104.053637 ; PMID: 15734919
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
Gene Resources
- UniProt: F4KGU2
- EMBL: CP002688
- AlphaFoldDB: F4KGU2
- EnsemblPlants: AT5G10360.2
- Gramene: AT5G10360.2
- ExpressionAtlas: AT5G10360
Sequences
cDNA Sequence
- >AT5G10360.2
GCAAAACCCTAAAAGCTGAGCCGCGTCGAGAGCATTTTATATCTTCAATCATCTTACGCAGGCTGTTGTAGCAGCAGTGTCTATCGGAGACGATGAAGTTCAACGTCGCCAATCCGACCACCGGGTGTCAAAAGAAACTCGAGATCGATGACGATCAAAAACTCCGCGCCTTTTTCGACAAGAGGCTCTCTCAGGAAGTTAGCGGAGATGCTCTAGGCGAGGAATTCAAGGGATACGTATTCAAGATCATGGGAGGATGTGACAAGCAAGGTTTCCCAATGAAACAAGGAGTTCTCACTCCAGGGCGTGTCCGTCTTTTGCTTCACCGAGGTACTCCTTGTTTTAGAGGACACGGAAGGAGGACTGGAGAGAGGAGACGAAAGTCTGTCCGTGGTTGCATTGTGAGCCCTGACCTGTCTGTTCTTAACTTGGTCATTGTGAAGAAGGGCAAGAAGGTTAGCAAGGCTCCTAAGATCCAGAGGCTTGTGACTCCATTGACCCTCCAGAGGAAGAGAGCTAGAATTGCTGACAAGAAGAAGAGAATCGCCAAGGCTAACTCTGATGCAGCTGATTACCAGAAGCTTCTTGCCTCCAGACTAAAGGAGCAGCGTGATCGCCGTAGTGAAAGTTTGGCCAAGAAGAGGTCTAGACTCTCTTCTGCTCCTGCTAAACCCGTTGCTGCTTAAACTGCCTCAAGATTAAGAAATTTCTTTCTCTCTAGTTTGTTTCTGGTCGTATTTAAGTTGCTCCACAGACATGAGAACGCCATTTTGAACACTATTTTTGGTTTCTGTTTTGTGTCAACTTTTCAAGCCTTTTATTATATCAAAGTTTTGAACCTCTTAGTAGTACGTTTGTTATATTTAGTTCTTATTTATATGCCCGTTTGTTGATAGTAAATGACCAGATGTCTTCATTATTAGATAAACTGATGACCTACCTTTAA - >AT5G10360.1
GCAAAACCCTAAAAGCTGAGCCGCGTCGAGAGCATTTTATATCTTCAATCATCTTACGCAGGCTGTTGTAGCAGCAGTGTCTATCGGAGACGATGAAGTTCAACGTCGCCAATCCGACCACCGGGTGTCAAAAGAAACTCGAGATCGATGACGATCAAAAACTCCGCGCCTTTTTCGACAAGAGGCTCTCTCAGGAAGTTAGCGGAGATGCTCTAGGCGAGGAATTCAAGGGATACGTATTCAAGATCATGGGAGGATGTGACAAGCAAGGTTTCCCAATGAAACAAGGAGTTCTCACTCCAGGGCGTGTCCGTCTTTTGCTTCACCGAGGTACTCCTTGTTTTAGAGGACACGGAAGGAGGACTGGAGAGAGGAGACGAAAGTCTGTCCGTGGTTGCATTGTGAGCCCTGACCTGTCTGTTCTTAACTTGGTCATTGTGAAGAAGGGCAAGAAGGTTAGCAAGGCTCCTAAGATCCAGAGGCTTGTGACTCCATTGACCCTCCAGAGGAAGAGAGCTAGAATTGCTGACAAGAAGAAGAGAATCGCCAAGGCTAACTCTGATGCAGCTGATTACCAGAAGCTTCTTGCCTCCAGACTAAAGGAGCAGCGTGATCGCCGTAGTGAAAGTTTGGCCAAGAAGAGGTCTAGACTCTCTTCTGCTCCTGCTAAACCCGTTGCTGCTTAAACTGCCTCAAGATTAAGAAATTTCTTTCTCTCTAGTTTGTTTCTGGTCGTATTTAAGTTGCTCCACAGACATGAGAACGCCATTTTGAACACTATTTTTGGTTTCTGTTTTGTGTCAACTTTTCAAGCCTTTTATTATATCAAAGTTTTGAACCTCTTAGTAGTACGTTTGTTATATTTAGTTCTTATTTATATGCCCGTTTGTTGATAGTAAATGACCAGATGTCTTCATTATTAGATAAACTGATGACCTACCTTTAA
CDS Sequence
Protein Sequence