AT5G09810

Gene Details

Gene ID: AT5G09810
Gene Symbol: ACT7, AtACT7
Gene Name: actin 7
Description: actin 7;(source:Araport11)
TAIR Accession: locus:2178128
Genome: Araport11_genome_release
Species: Arabidopsis thaliana

Functional Descriptions

PO:0000282 — trichome — tricoma (Spanish, exact), 毛茸、糸状体、毛 (Japanese, exact), seta (related), setae (related), capilli (narrow), capillus (narrow), cilia (narrow), cilium (narrow), glochid (narrow), glochidia (narrow), glochidium (narrow), hair (narrow), lepides (narrow), lepis (narrow), non-secretory trichome (narrow), scale (narrow), squama (narrow), squamae (narrow), squamella (narrow), squamellae (narrow), squamule (narrow), barb trichome (broad), bristle (broad)
PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)

GO:0048767 — acts upstream of or within — root hair elongation
GO:0048364 — acts upstream of or within — root development
GO:0009733 — acts upstream of or within — response to auxin
GO:0009506 — located in — plasmodesma
GO:0009941 — located in — chloroplast envelope
GO:0008104 — involved in — protein localization
GO:0005829 — located in — cytosol
GO:0009416 — acts upstream of or within — response to light stimulus
GO:0009570 — located in — chloroplast stroma
GO:0005737 — located in — cytoplasm
GO:0009611 — acts upstream of or within — response to wounding
GO:0005730 — located in — nucleolus
GO:0006893 — involved in — Golgi to plasma membrane transport
GO:0009505 — located in — plant-type cell wall
GO:0007010 — acts upstream of or within — cytoskeleton organization
GO:0051301 — acts upstream of or within — cell division
GO:0010053 — acts upstream of or within — root epidermal cell differentiation
GO:0005515 — enables — protein binding
GO:0005856 — located in — cytoskeleton
GO:0009845 — acts upstream of or within — seed germination
GO:0005200 — enables — structural constituent of cytoskeleton
GO:0005886 — located in — plasma membrane
GO:0005739 — located in — mitochondrion

act2-1/act7-4 — Plants are dwarf and reach only 15% of the height of wild type. Roots lack root hairs- the initiate but do not develop further than a bulge. Leaves are small with reduced surface area and fewer lobes. Leaf trichomes are abnormal and contain fewer branches. Also defects in flower morphology, reduced fertility, abnormal inflorescence structure and abnormal silique development.
act7 — Slow to produce callus in response to hormones
act7-4 — Abnormal roots. Roots are shorted and have fewer root hairs (ca. 20% less than wild type). Root epidermal cells have abnormal morphology and bulge.
act8-2/act7-4 — Plants are dwarf. Leaves are smaller and contain fewer cells and fewer lobes than wild type. Reduced number of trichome branches. Petals are narrow. Roots are more severely affected and produce short root hairs. Cell files are irregular and the elongation zone is much reduced.
unp1 — Aberrant nuclei position in dark-adapted and blue light-induced leaves. Reduced number of actin filaments, decrease in velocity of cytoplasmic streaming. Upwardly bent leaf petioles, reduced plant height, seed number per fruit, and fruit length. Sherical nuclei of pavement cells.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>AT5G09810.1
CCCAGATTTTTTATTTGGGAAATAATAGAAGAAATAGAAAAAAATAAAAGAGTGAGAAAAATCGTAGAGCTATATATTCGCACATGTACTCGTTTCGCTTTCCTTAGTGTTAGCTGCTGCCGCTGTTGTTTCTCCTCCATTTCTCTATCTTTCTCTCTCGCTGCTTCTCGAATCTTCTGTATCATCTTCTTCTTCTTCAAGTGAAAAATGGCCGATGGTGAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGTTTTGCTGGTGATGATGCCCCGAGAGCAGTGTTCCCAAGTATTGTTGGTCGTCCTAGGCACACTGGTGTCATGGTTGGTATGGGTCAGAAAGATGCTTACGTTGGTGATGAAGCTCAGTCCAAGAGAGGTATCCTCACTCTGAAGTATCCAATCGAACATGGTATTGTAAGTAACTGGGATGACATGGAAAAGATATGGCATCACACTTTCTACAACGAGCTTCGTGTTGCCCCTGAGGAGCACCCAGTTCTACTCACAGAGGCACCTCTTAACCCTAAAGCTAACAGGGAGAAGATGACTCAGATCATGTTTGAGACATTCAATGTCCCTGCCATGTATGTTGCCATTCAGGCCGTTCTTTCTCTCTATGCCAGTGGTCGTACAACCGGTATTGTGCTCGATTCTGGTGATGGTGTGTCTCACACTGTGCCAATCTACGAGGGGTATGCTCTTCCTCATGCTATCCTTCGTCTTGATCTTGCGGGTCGGGATCTCACAGACTCACTCATGAAGATTCTCACTGAGAGAGGTTACATGTTCACCACTACCGCAGAACGGGAAATTGTCCGTGACATAAAGGAGAAACTTGCTTATGTCGCTCTTGACTACGAGCAAGAGCTAGAGACAGCCAAGAGCAGTTCTTCAGTGGAGAAGAACTACGAGCTACCTGATGGACAAGTCATAACCATCGGAGCTGAGAGATTCCGTTGTCCTGAGGTTCTGTTCCAGCCATCGCTCATCGGAATGGAAGCTCCTGGAATCCATGAAACAACTTACAACTCCATCATGAAATGTGATGTCGATATCAGGAAGGATCTCTATGGAAACATCGTTCTCAGTGGTGGTTCCACCATGTTCCCAGGAATTGCTGACCGTATGAGCAAAGAGATCACCGCTCTTGCACCTAGCAGCATGAAGATCAAGGTGGTTGCACCGCCAGAGAGAAAATACAGTGTCTGGATCGGAGGATCAATCCTTGCATCCCTCAGCACCTTCCAACAGATGTGGATTTCAAAGAGTGAGTACGATGAGTCAGGTCCATCGATTGTTCACAGGAAATGCTTCTAAGTGTGTCTTGTCTTATCTGGTTCGTGGTGGTGAGTTTGTTACAAAAAAATCTATTTTCCCTAGTTGAGATGGGAATTGAACTATCTGTTGTTATGTGGATTTTATTTTCTTTTTTCTCTTTAGAACCTTATGGTTGTGTCAAGAAGTCTTGTGTACTTTAGTTTTATATCTCTGTTTTATCTCTTCTATTTTCTTTAGGATGCTTGTGATGATGCTGTTTTTTTTTGTCCCTAAGCAAAAAAATATCATATTATATTTGGTCCTTGGTTCATTTTTTTGGTTTTTTTTTGTCTTCACATATAAATATTGTTTGAATGTCTTCAATCTTTTATTTGTATGAGACAATTATTTAAGTATCGGGTGACAATGCAGCTATTATGTATTGTCGATTGTTATATTGGCGCCCAAAATATATACTTAGCCTAAGAATTTGGTAAGTGAGTGGCTTATGTTTTACTCCAGCAAAAATTG

CDS Sequence

Protein Sequence