Gene Details:

  • Gene ID: AT5G09650
  • Gene Symbol: AtPPa6, PPa6
  • Gene Name: pyrophosphorylase 6, pyrophosphorylase 6
  • Description: pyrophosphorylase 6;(source:Araport11)
  • TAIR Accession: locus:2144766
  • Genome: Araport11_genome_release
  • Species: Arabidopsis thaliana

Transcripts:

Plant Ontology Annotations:

  • PO:0000013  — cauline leaf — hoja caulinar (Spanish, exact), 茎生葉、茎葉 (Japanese, exact)
  • PO:0000014  — rosette leaf — hoja en roseta (Spanish, exact), ロゼット葉 (Japanese, exact)
  • PO:0009001  — fruit — frucht (exact, German), fruto (exact, Spanish), 果実 (exact, Japanese), coenocarp (narrow), syncarp (narrow), aggregate fruit (broad), compound fruit (broad), dehiscent fruit (broad), diaspore (broad), indehiscent fruit (broad), multiple fruit (broad), propagule (broad)
  • PO:0009005  — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
  • PO:0009046  — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
  • PO:0009047  — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
  • PO:0000084  — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)

Gene Ontology:

  • GO:0009570  — located in — chloroplast stroma
  • GO:1901566  — acts upstream of or within — organonitrogen compound biosynthetic process
  • GO:0009507  — located in — chloroplast
  • GO:0019761  — acts upstream of or within — glucosinolate biosynthetic process
  • GO:0098542  — acts upstream of or within — defense response to other organism
  • GO:0033993  — acts upstream of or within — response to lipid
  • GO:0000287  — enables — magnesium ion binding
  • GO:0006796  — involved in — phosphate-containing compound metabolic process
  • GO:0046394  — acts upstream of or within — carboxylic acid biosynthetic process
  • GO:0004427  — enables — inorganic diphosphate phosphatase activity
  • GO:0009536  — located in — plastid
  • GO:0009941  — located in — chloroplast envelope
  • GO:1901605  — acts upstream of or within — alpha-amino acid metabolic process
  • GO:0044271  — acts upstream of or within — cellular nitrogen compound biosynthetic process
  • GO:0022607  — acts upstream of or within — cellular component assembly
  • GO:0005886  — located in — plasma membrane
  • GO:0032787  — acts upstream of or within — monocarboxylic acid metabolic process
  • GO:0006629  — acts upstream of or within — lipid metabolic process
  • GO:0009579  — located in — thylakoid
  • GO:0009611  — acts upstream of or within — response to wounding

Literature:

Sequences:

cDNA Sequence
  • >AT5G09650.1
    TTTTTGTGTTCTGTCTTTCTTGGTGGTGTGATAAAGAATAAAGAGAGCCAGTCGAGGGTAAAACGAAAGGCCACCATTTTCAATCTTTCCACAATAATGGCGGCTACTAGAGTGTTAACTGCAGCGACGGCCGTGACCCAAACCACCTCCTGTTTCCTCGCCAAGCAAGCTTTCACTCTTCCGGCGAAGAAATCCTGCGGCGGATTTGGTGGTCTCTGCTTCAGCAGAAGAGCTTTGGTGTTGAAATCTAAGAGACCTTTCTCCTGCAGTGCCATTTACAATCCTCAGGTTAAGGTTCAAGAAGAAGGTCCGGCCGAATCCCTAGATTATCGAGTTTTCTTCCTCGATGGTTCTGGAAAGAAGGTTTCTCCATGGCATGATATACCATTGACCTTAGGCGATGGAGTTTTCAACTTTATAGTTGAAATACCTAAAGAGTCAAAAGCAAAAATGGAGGTTGCTACTGATGAAGATTTCACTCCTATTAAGCAGGATACTAAGAAGGGGAAGCTCAGATATTATCCGTATAACATTAACTGGAACTATGGGTTGCTTCCTCAAACATGGGAAGATCCATCTCATGCAAATTCTGAAGTTGAAGGATGTTTTGGGGATAATGATCCAGTTGATGTTGTTGAGATTGGTGAAACACAAAGGAAGATAGGCGATATTCTAAAGATAAAGCCTTTAGCTGCTTTAGCTATGATTGATGAAGGTGAGCTAGACTGGAAGATTGTTGCCATTTCTTTGGATGACCCAAAAGCTCATCTTGTGAATGATGTTGAAGATGTTGAGAAACATTTCCCGGGTACACTAACAGCCATTAGAGACTGGTTTAGAGACTACAAGATCCCAGATGGAAAGCCTGCTAACAGATTTGGTCTTGGAGACAAACCAGCAAACAAAGACTATGCTTTGAAGATCATCCAAGAAACAAATGAATCATGGGCTAAACTTGTGAAGAGATCAGTTGATGCTGGAGACCTTTCACTTTACTGAACATATTTTGCAATGTCGACTTATGAGGTCGAATAATGAATAGACTCAAGATTCCTATATCATTCTTGTTGTTTCCTTTCAATTGAGATGTAAACATTGGGATTTGGATTTTGTTTTTCACCATTGATGACTGAGAAGTAATAAAATGACTTTCTGCTTTGGAAATATTTAAATGGAATATG
CDS Sequence
Protein Sequence