Information report for AT5G08790
Gene Details
|
|
Functional Descriptions
- PO:0003018 — root cap of lateral root — caliptra de la raíz lateral (Spanish, exact), 側根の根冠 (Japanese, exact)
- PO:0006340 — adult vascular leaf — hoja adulta (Spanish, exact), 維管束系の成葉 (Japanese, exact)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020121 — lateral root — raíz lateral (Spanish, exact), 側根 (Japanese, exact)
Functional Keywords
Literature and News
- Differential induction of two potato genes, Stprx2 and StNAC, in response to infection by Phytophthora infestans and to wounding. DOI: 10.1023/a:1010639225091 ; PMID: 11516145
- Genomic analysis of the unfolded protein response in Arabidopsis shows its connection to important cellular processes. DOI: 10.1105/tpc.007609 ; PMID: 12566592
- Interactions between plant RING-H2 and plant-specific NAC (NAM/ATAF1/2/CUC2) proteins: RING-H2 molecular specificity and cellular localization. DOI: 10.1042/BJ20021123 ; PMID: 12646039
- Changes in gene expression in Arabidopsis shoots during phosphate starvation and the potential for developing smart plants. DOI: 10.1104/pp.103.020941 ; PMID: 12805589
- SAGE analysis of transcriptome responses in Arabidopsis roots exposed to 2,4,6-trinitrotoluene. DOI: 10.1104/pp.103.028019 ; PMID: 14551330
- Molecular characterization of Brassica napus NAC domain transcriptional activators induced in response to biotic and abiotic stress. DOI: 10.1023/b:plan.0000006944.61384.11 ; PMID: 14750526
- Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DOI: 10.1093/dnares/10.6.239 ; PMID: 15029955
- Structure of the conserved domain of ANAC, a member of the NAC family of transcription factors. DOI: 10.1038/sj.embor.7400093 ; PMID: 15083810
- The transcription factor ATAF2 represses the expression of pathogenesis-related genes in Arabidopsis. DOI: 10.1111/j.1365-313X.2005.02488.x ; PMID: 16115070
- Identification of genes of the plant-specific transcription-factor families cooperatively regulated by ethylene and jasmonate in Arabidopsis thaliana. DOI: 10.1007/s10265-006-0287-x ; PMID: 16820983
- Light has a specific role in modulating Arabidopsis gene expression at low temperature. DOI: 10.1186/1471-2229-8-13 ; PMID: 18230142
- Transcriptional responses of Arabidopsis thaliana plants to As (V) stress. DOI: 10.1186/1471-2229-8-87 ; PMID: 18684332
- NAC family proteins NARS1/NAC2 and NARS2/NAM in the outer integument regulate embryogenesis in Arabidopsis. DOI: 10.1105/tpc.108.060160 ; PMID: 18849494
- DNA binding specificity of ATAF2, a NAC domain transcription factor targeted for degradation by Tobacco mosaic virus. DOI: 10.1186/1471-2229-12-157 ; PMID: 22937923
- ATAF2 integrates Arabidopsis brassinosteroid inactivation and seedling photomorphogenesis. DOI: 10.1242/dev.124347 ; PMID: 26493403
- SNAC-As, stress-responsive NAC transcription factors, mediate ABA-inducible leaf senescence. DOI: 10.1111/tpj.13067 ; PMID: 26518251
- The plant hormone auxin directs timing of xylem development by inhibition of secondary cell wall deposition through repression of secondary wall NAC-domain transcription factors. DOI: 10.1111/ppl.12766 ; PMID: 29808599
- Transcription Factor ANAC074 Binds to NRS1, NRS2, or MybSt1 Element in Addition to the NACRS to Regulate Gene Expression. DOI: 10.3390/ijms19103271 ; PMID: 30347890
- CIRCADIAN CLOCK ASSOCIATED 1 and ATAF2 differentially suppress cytochrome P450-mediated brassinosteroid inactivation. DOI: 10.1093/jxb/erz468 ; PMID: 31639820
- Self-transcriptional repression of the Arabidopsis NAC transcription factor ATAF2 and its genetic interaction with phytochrome A in modulating seedling photomorphogenesis. DOI: 10.1007/s00425-020-03456-5 ; PMID: 32892254
- Two ATAF transcription factors ANAC102 and ATAF1 contribute to the suppression of cytochrome P450-mediated brassinosteroid catabolism in Arabidopsis. DOI: 10.1111/ppl.13339 ; PMID: 33491178
- Genome-wide identification and comprehensive analysis of the NAC transcription factor family in sunflower during salt and drought stress. DOI: 10.1038/s41598-021-98107-4 ; PMID: 34615898
- The upstream regulation of the root cell wall when Arabidopsis thaliana in response to toxic metal ions focusing on Al. DOI: 10.1080/15592324.2023.2178085 ; PMID: 36780917
- NAC1 regulates root ground tissue maturation by coordinating with the SCR/SHR-CYCD6;1 module in Arabidopsis. DOI: 10.1016/j.molp.2023.02.006 ; PMID: 36809880
- Identification of 118 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to chitin, a plant-defense elicitor. DOI: 10.1094/MPMI-20-8-0900 ; PMID: 17722694
Gene Resources
- UniProt: A0A178URJ7
- EMBL: CACRSJ010000110, CACSHJ010000096, LUHQ01000005
- AlphaFoldDB: A0A178URJ7
- EnsemblPlants: AT5G08790.1
- Gramene: AT5G08790.1
- KEGG: ath:AT5G08790
- Orthologous matrix: QSAPKWD
- ExpressionAtlas: AT5G08790
- InterPro: IPR003441, IPR036093
- PANTHER: PTHR31744, PTHR31744:SF233
- SUPFAM: SSF101941
- PROSITE: PS51005
- Gene3D: 2.170.150.80
- OrthoDB: A0A178URJ7
- SWISS-MODEL: A0A178URJ7
Sequences
cDNA Sequence
- >AT5G08790.1
TTTCTACACTCTCTTTCCCAATGGAGATGGTCTAAAGTCGGTCAACAATTCACAAAAGGTTTAAGTGACGCAAGCAATGACAACATCTAAGTCGACTATCCAATAATATTACGCCACGTATATATCCAGCTGGCTGCGGTCAGCGTAGAAAAGAAAACGGTCTGTTTTGCCGCACGTGCTTGAAAATCCCCTCGTGTCATCTCTTTTCTGTTTTTTGTGTTTTTTCAATTTAAATTAATTAAAACATTTCGGCGATTTTCGTCCTTATAAAACCTTCGTCGCCTCACTCACATATCCTCGATTACAATCTTGAGCAGACGAAGAAAACCCAAAAAAAATCCAGATCCAGCTGAAATTGAATTTTCAACCAACGAAGAAGAGATTTTTCCAAGAGCAACAGACAAGAAGAAGAGAATGAAGTCGGAGCTAAATTTACCAGCTGGGTTCCGATTCCATCCAACGGACGAGGAGCTTGTGAAATTCTACTTGTGCCGGAAATGTGCTTCCGAGCAGATCTCGGCTCCGGTTATCGCCGAGATTGATCTCTACAAGTTCAATCCTTGGGAGCTTCCAGAGATGTCTCTGTACGGAGAGAAAGAGTGGTACTTCTTCTCACCTAGAGATCGGAAATACCCAAACGGTTCGCGTCCTAACCGGGCAGCAGGAACCGGTTATTGGAAAGCTACCGGAGCAGATAAACCGATTGGTAAACCGAAGACGTTGGGTATCAAGAAAGCACTCGTCTTCTACGCAGGGAAAGCTCCAAAAGGGATTAAGACCAATTGGATAATGCATGAGTATCGTCTCGCTAATGTTGATAGATCAGCTTCTGTTAACAAAAAGAACAACCTACGACTTGATGATTGGGTTTTATGTCGAATATACAACAAGAAAGGAACCATGGAGAAGTATTTCCCCGCGGATGAGAAGCCGAGGACCACGACAATGGCTGAACAGTCATCATCACCTTTTGATACATCAGACTCGACTTACCCGACATTGCAAGAGGATGATTCCAGCAGCTCAGGTGGTCACGGTCACGTGGTGTCACCGGATGTTTTGGAGGTTCAGAGCGAGCCTAAATGGGGAGAGCTTGAGGATGCTTTGGAAGCTTTTGATACTTCAATGTTTGGTAGTTCCATGGAGTTGTTGCAGCCTGACGCTTTTGTCCCTCAGTTCTTGTATCAGTCTGATTATTTCACTTCCTTCCAGGATCCGCCTGAGCAGAAACCATTCTTGAATTGGAGTTTTGCTCCACAGGGGTAAAAACGGAAGAGACCAAAAAAGGTGTTTGCTAGTAGTACTGTGATGTGCCAGAGAGAAGAGTCTCATCTCAACTCATCCCTGGCTCTTAGTAGTAAAAGAAGATTGTAGAATGTTAATAGCTTTTAGCATCAATGTCTCATTAGCAGGCACATTCTTGTTCTTTCATGAGAAGTTTATATGAAAACTAAAAATTTATATTCAAATTCTTCAAGATGTTGCACTTATGTAGATACTGATATTAAATAACAACCTAACCTTTATGAG
CDS Sequence
Protein Sequence