Gene Details:
- Gene ID: AT5G08280
- Gene Symbol: HEMC, RUG1
- Gene Name: hydroxymethylbilane synthase, RUGOSA 1
- Description: hydroxymethylbilane synthase;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
Literature:
- Genome organization in Arabidopsis thaliana: a survey for genes involved in isoprenoid and chlorophyll metabolism. DOI: 10.1023/a:1023005504702 ; PMID: 12777052
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Gene expression profiling of the tetrapyrrole metabolic pathway in Arabidopsis with a mini-array system. DOI: 10.1104/pp.104.042408 ; PMID: 15326282
- Identification of a vinyl reductase gene for chlorophyll synthesis in Arabidopsis thaliana and implications for the evolution of Prochlorococcus species. DOI: 10.1105/tpc.104.027276 ; PMID: 15632054
- Proteomic analysis and extensive protein identification from dry, germinating Arabidopsis seeds and young seedlings. DOI: 10.5483/bmbrep.2005.38.6.650 ; PMID: 16336779
- Modifications to the Arabidopsis defense proteome occur prior to significant transcriptional change in response to inoculation with Pseudomonas syringae. DOI: 10.1104/pp.106.086231 ; PMID: 17028151
- Global transcription profiling reveals differential responses to chronic nitrogen stress and putative nitrogen regulatory components in Arabidopsis. DOI: 10.1186/1471-2164-8-281 ; PMID: 17705847
- Comparative mapping of Brassica juncea and Arabidopsis thaliana using Intron Polymorphism (IP) markers: homoeologous relationships, diversification and evolution of the A, B and C Brassica genomes. DOI: 10.1186/1471-2164-9-113 ; PMID: 18315867
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- PORPHOBILINOGEN DEAMINASE deficiency alters vegetative and reproductive development and causes lesions in Arabidopsis. DOI: 10.1371/journal.pone.0053378 ; PMID: 23308205
- Transcriptional Regulation of Tetrapyrrole Biosynthesis in Arabidopsis thaliana. DOI: 10.3389/fpls.2016.01811 ; PMID: 27990150
- Porphobilinogen deaminase HEMC interacts with the PPR-protein AtECB2 for chloroplast RNA editing. DOI: 10.1111/tpj.13672 ; PMID: 28850756
- Shade represses photosynthetic genes by disrupting the DNA binding of GOLDEN2-LIKE1. DOI: 10.1093/plphys/kiad029 ; PMID: 36702576
- Proteomic study of the Arabidopsis thaliana chloroplastic envelope membrane utilizing alternatives to traditional two-dimensional electrophoresis. DOI: 10.1021/pr034025j ; PMID: 12938931
- Modifications to the Arabidopsis defense proteome occur prior to significant transcriptional change in response to inoculation with Pseudomonas syringae. DOI: 10.1104/pp.106.086231 ; PMID: 17028151
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. DOI: 10.1016/j.phytochem.2008.04.007 ; PMID: 18538804
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequences:
cDNA Sequence
- >AT5G08280.1
GTGATTAAGGTAGTAGAACACCATAATCTGGTATGAGTCATTCGTAGAGGAATAAAGCTCTAAAATCTAATTATCCTATCCAATATCCTCTCATAGAGGTGAGAGCTAAGATTTTCCCATCAACTCCATTTGAAGCGAAATTCTCTGATCTCTCTTCATTTTATTTTCCCTCTACATCTCTCCCAACGATTTCCAAATCTCACTTCACTTTGGCTCCTCCACCTGAATCCATGGATATTGCTTCGTCATCTCTCTCACAAGCTCACAAAGTCGTTCTCACGCGTCAACCTTCTTCCCGGGTCAACACCTGCTCCCTTGGCTCGGTCTCCGCTATCGGATTCTCTCTTCCGCAGATTAGCTCTCCAGCTTTAGGTAAATGTCGCCGGAAACAAAGCTCTTCTGGGTTCGTGAAAGCTTGTGTTGCTGTTGAACAGAAAACCCGAACTGCTATCATCAGAATTGGCACAAGGGGAAGTCCTCTAGCACTTGCTCAAGCATACGAGACGCGAGAAAAGCTCAAGAAGAAACACCCTGAACTCGTTGAAGATGGAGCTATTCATATCGAGATCATTAAAACGACTGGTGATAAGATTCTTTCGCAACCGCTTGCTGATATTGGTGGGAAAGGACTTTTCACCAAAGAAATAGACGAGGCCTTGATAAATGGTCATATTGACATAGCTGTGCACTCAATGAAAGATGTCCCAACTTACTTACCAGAAAAAACGATTTTACCTTGTAACCTTCCGCGTGAGGATGTTCGAGATGCGTTTATTTGTCTAACTGCAGCCACGTTAGCTGAGCTTCCAGCTGGAAGCGTTGTGGGAACAGCTTCTCTCAGGAGAAAATCGCAGATTCTCCACAAATATCCTGCATTACATGTTGAGGAAAACTTCAGGGGTAATGTGCAGACAAGACTATCAAAACTACAAGGAGGAAAGGTCCAAGCAACTCTATTAGCACTAGCTGGTCTTAAGAGATTGAGTATGACAGAGAATGTCGCATCTATCTTATCTCTCGATGAAATGCTTCCAGCTGTTGCTCAAGGAGCTATTGGAATTGCCTGTAGAACTGATGATGATAAAATGGCAACTTACTTAGCCTCACTGAACCACGAGGAAACAAGACTAGCGATTTCATGCGAGAGAGCTTTTCTTGAAACGCTAGATGGCTCATGCCGTACTCCTATTGCTGGATACGCATCCAAGGACGAAGAAGGCAACTGCATTTTCAGAGGATTGGTTGCTTCCCCTGACGGTACTAAAGTTCTTGAGACCTCAAGAAAAGGTCCATACGTGTATGAAGACATGGTGAAGATGGGAAAAGACGCGGGGCAAGAATTGCTATCTCGTGCTGGTCCTGGCTTCTTCGGCAACTGAGCCATTCGAAGAAGAGGAGGAAGAGATGTGACACGGACAAAGTCTAGTGTTTAGGAGTGATTCAACATCTTGAAGTCCCGTTTCTTCCTCCGAACTGTTGTAACTTTTTTGATTTTGAGAGAAACATGACCTTTTGTTTATTGATTGTTTTGTTGTATTTAGATTAAATTCATCTTGCAATTGTACCCCTTTTTTTCTGTCCCACGATGAAACTAGTACACAAGAAATTAGAGAGACAAAATAAAATCCAGAGACTTCAGCTTC
CDS Sequence
Protein Sequence