Information report for AT5G07690
Gene Details
|
|
Functional Descriptions
- PO:0006325 — inflorescence axis node — nodo de la inflorescencia (Spanish, exact), 花序節 (Japanese, exact)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
Functional Keywords
Literature and News
- Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana. DOI: 10.1046/j.1365-313x.1998.00278.x ; PMID: 9839469
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The R2R3-MYB gene family in Arabidopsis thaliana. DOI: 10.1016/s1369-5266(00)00199-0 ; PMID: 11597504
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Transcriptional divergence of the duplicated oxidative stress-responsive genes in the Arabidopsis genome. DOI: 10.1111/j.1365-313X.2004.02295.x ; PMID: 15634198
- The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. DOI: 10.1105/tpc.016980 ; PMID: 14742872
- The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. DOI: 10.1007/s11103-005-2910-y ; PMID: 16463103
- How to decide? Different methods of calculating gene expression from short oligonucleotide array data will give different results. DOI: 10.1186/1471-2105-7-137 ; PMID: 16539732
- Expression profiling and local adaptation of Boechera holboellii populations for water use efficiency across a naturally occurring water stress gradient. DOI: 10.1111/j.1365-294X.2006.02818.x ; PMID: 16626450
- Omics-based identification of Arabidopsis Myb transcription factors regulating aliphatic glucosinolate biosynthesis. DOI: 10.1073/pnas.0611629104 ; PMID: 17420480
- Genome-wide gene expression analysis reveals a critical role for CRYPTOCHROME1 in the response of Arabidopsis to high irradiance. DOI: 10.1104/pp.107.098293 ; PMID: 17478635
- Plastic and adaptive gene expression patterns associated with temperature stress in Arabidopsis thaliana. DOI: 10.1038/sj.hdy.6800975 ; PMID: 17473866
- The impact of the absence of aliphatic glucosinolates on insect herbivory in Arabidopsis. DOI: 10.1371/journal.pone.0002068 ; PMID: 18446225
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- The transcript and metabolite networks affected by the two clades of Arabidopsis glucosinolate biosynthesis regulators. DOI: 10.1104/pp.108.124784 ; PMID: 18829985
- Differential effects of indole and aliphatic glucosinolates on lepidopteran herbivores. DOI: 10.1007/s10886-010-9825-z ; PMID: 20617455
- Role of camalexin, indole glucosinolates, and side chain modification of glucosinolate-derived isothiocyanates in defense of Arabidopsis against Sclerotinia sclerotiorum. DOI: 10.1111/j.1365-313X.2011.04578.x ; PMID: 21418358
- Using biologically interrelated experiments to identify pathway genes in Arabidopsis. DOI: 10.1093/bioinformatics/bts038 ; PMID: 22271267
- Metabolic and transcriptomic changes induced in Arabidopsis by the rhizobacterium Pseudomonas fluorescens SS101. DOI: 10.1104/pp.112.207324 ; PMID: 23073694
- Water stress and aphid feeding differentially influence metabolite composition in Arabidopsis thaliana (L.). DOI: 10.1371/journal.pone.0048661 ; PMID: 23144921
- Glucose signalling positively regulates aliphatic glucosinolate biosynthesis. DOI: 10.1093/jxb/ers399 ; PMID: 23329848
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- Jasmonic acid and glucose synergistically modulate the accumulation of glucosinolates in Arabidopsis thaliana. DOI: 10.1093/jxb/ert348 ; PMID: 24151308
- Promoter-based integration in plant defense regulation. DOI: 10.1104/pp.114.248716 ; PMID: 25352272
- Update on the role of R2R3-MYBs in the regulation of glucosinolates upon sulfur deficiency. DOI: 10.3389/fpls.2014.00626 ; PMID: 25426131
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- New nodes and edges in the glucosinolate molecular network revealed by proteomics and metabolomics of Arabidopsis myb28/29 and cyp79B2/B3 glucosinolate mutants. DOI: 10.1016/j.jprot.2016.02.012 ; PMID: 26915584
- The rolB gene activates secondary metabolism in Arabidopsis calli via selective activation of genes encoding MYB and bHLH transcription factors. DOI: 10.1016/j.plaphy.2016.02.015 ; PMID: 26913794
- Glucosinolates from Host Plants Influence Growth of the Parasitic Plant Cuscuta gronovii and Its Susceptibility to Aphid Feeding. DOI: 10.1104/pp.16.00613 ; PMID: 27482077
- Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29. DOI: 10.3389/fpls.2017.00534 ; PMID: 28443122
- Network-Guided Discovery of Extensive Epistasis between Transcription Factors Involved in Aliphatic Glucosinolate Biosynthesis. DOI: 10.1105/tpc.17.00805 ; PMID: 29317470
- Mitochondrial function modulates touch signalling in Arabidopsis thaliana. DOI: 10.1111/tpj.14183 ; PMID: 30537160
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- Abscisic acid-mediated induction of FLAVIN-CONTAINING MONOOXYGENASE 2 leads to reduced accumulation of methylthioalkyl glucosinolates in Arabidopsis thaliana. DOI: 10.1016/j.plantsci.2020.110764 ; PMID: 33487349
- Structural insights into partner selection for MYB and bHLH transcription factor complexes. DOI: 10.1038/s41477-022-01223-w ; PMID: 35995835
- Arabidopsis transcriptome dataset of the response of imbibed wild-type and glucosinolate-deficient seeds to nitrogen-containing compounds. DOI: 10.1016/j.dib.2023.109047 ; PMID: 37006386
- Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana. DOI: 10.1046/j.1365-313x.1998.00278.x ; PMID: 9839469
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
- The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. DOI: 10.1007/s11103-005-2910-y ; PMID: 16463103
- Omics-based identification of Arabidopsis Myb transcription factors regulating aliphatic glucosinolate biosynthesis. DOI: 10.1073/pnas.0611629104 ; PMID: 17420480
Gene Resources
- UniProt: A0A654FZ82
- EMBL: CACRSJ010000110
- AlphaFoldDB: A0A654FZ82
- EnsemblPlants: AT5G07690.1
- Gramene: AT5G07690.1
- KEGG: ath:AT5G07690
- Orthologous matrix: NDMDEFD
- ExpressionAtlas: AT5G07690
- InterPro: IPR001005, IPR009057, IPR015495
- PANTHER: PTHR47994, PTHR47994:SF5
- SUPFAM: SSF46689
- PROSITE: PS50090, PS51294
- Gene3D: 1.10.10.60
- SWISS-MODEL: A0A654FZ82
- Conserved Domain Database: cd00167
Sequences
cDNA Sequence
- >AT5G07690.1
GGGGTCAAAGTACTCTTGATGATGAGTTGATATTCTTATTTAAAAAAAGCTTATTACTTATTTAAGTTATTTCAAAAAGTACATTCTACACGAGTGCCAGGCTTATATATATGCATAAACATATATAATTATGCATGGAGGAGTAGTAGCTTGCAATGTCTTGAAACTTTGATATATCTTCTCCTAGTCTTTCTTTTAAATGTTTAATATGAAAACACAAAATCCTACAACGGTCGTCTACCACAGTTTCTCAGTCAGTTTCATATTCAGATGCATCAGAGTTCTCATCAAGAGATCTATCAGTCTATTGCCTTAAACTCGACGACATTCTGTTTTTTTTTTCTTTTCTTATTTTTTCTTTTTCTTATTTCTTACCTATAGGTTGTATGTAAATCTATATCAAAAAAAGAAGAAAAACAAGATGTCAAGAAAGCCATGTTGTGTGGGAGAAGGACTGAAGAAAGGAGCATGGACTGCCGAAGAAGACAAGAAACTCATCTCTTACATTCATGAACACGGTGAAGGAGGCTGGCGTGACATTCCCCAAAAAGCTGGACTAAAACGATGTGGAAAGAGTTGTAGATTGCGATGGGCTAACTATTTGAAACCTGACATCAAGAGAGGAGAGTTTAGCTATGAGGAGGAACAGATTATCATCATGCTACACGCTTCTCGCGGCAACAAGTGGTCAGTCATAGCGAGACATTTGCCCAAAAGAACAGATAACGAGATTAAGAACTACTGGAACACGCATCTCAAAAAGCTCCTGATCGATAAGGGAATCGATCCCGTGACCCACAAGCCACTTGCCTATGACTCAAACCCGGATGAGCAATCGCAATCGGGTTCCATCTCTCCAAAGTCTCTTCCTCCTTCAAGCTCCAAAAATGTACCGGAGATAACCAGCAGTGACGAGACACCGAAATATGATGCTTCCTTGAGCTCCAAGAAACGTTGTTTTAAGAGATCGAGTTCTACATCAAAACTGTTAAACAAAGTTGCAGCTAGGGCTTCTTCCATGGGAACTATACTAGGCGCCTCCATCGAAGGAACCTTGATCAGCTCTACACCGTTGTCTTCATGTCTAAATGATGACTTTTCTGAAACAAGTCAATTTCAGATGGAAGAATTTGATCCATTCTATCAGTCATCTGAACACATAATTGATCATATGAAAGAAGATATCAGCATCAACAATTCCGAATACGATTTCTCGCAGTTTCTCGAGCAGTTTAGTAACAACGAAGGGGAAGAAGCTGACAATACTGGAGGAGGATATAACCAAGATCTTCTTATGTCTGATGTCTCATCAACAAGCGTTGATGAAGACGAGATGATGCAAAACATAACTGGTTGGTCAAATTATCTCCTTGACCATTCCGATTTCAATTATGACACGAGCCAAGATTACGACGACAAGAACTTCATATGATCCGTTGATTGCTTACCGGACTAGAGTTGACCGGTTAATGTCATATGGTTCTCTTAGATATTTGTCAAGTTATAGTAAAGGTCCACTATAGGGTCACTATATATTAATATTCAGTAATGGATTCTCTTAGTTAGAGAACCTTGTGATGCCGTGGATCAATTAGTATTTGATTTGCGGGAGACACGAGTTTTTTTTCCTTCTATTGTTGTTTGTGGATTTACGTACTATAAATAATAAATAAAACACCCATTTGATTGCAAGCGTTCACTGTACTAAAACCATTTGATTTAAAGTTTGAG
CDS Sequence
Protein Sequence