Gene Details:
- Gene ID: AT5G07460
- Gene Symbol: ATMSRA2, MRSA2, PMSR2
- Gene Name: ARABIDOPSIS THALIANA METHIONINE SULFOXIDE REDUCTASE 2, peptidemethionine sulfoxide reductase 2
- Description: peptidemethionine sulfoxide reductase 2;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
- root , root , stem , guard cell
Literature:
- SAGE analysis of transcriptome responses in Arabidopsis roots exposed to 2,4,6-trinitrotoluene. DOI: 10.1104/pp.103.028019 ; PMID: 14551330
- The Arabidopsis plastidic methionine sulfoxide reductase B proteins. Sequence and activity characteristics, comparison of the expression with plastidic methionine sulfoxide reductase A, and induction by photooxidative stress. DOI: 10.1104/pp.105.062430 ; PMID: 15923321
- Proteomic analysis and extensive protein identification from dry, germinating Arabidopsis seeds and young seedlings. DOI: 10.5483/bmbrep.2005.38.6.650 ; PMID: 16336779
- Plant methionine sulfoxide reductase A and B multigenic families. DOI: 10.1007/s11120-006-9097-1 ; PMID: 17031545
- Omics-based identification of Arabidopsis Myb transcription factors regulating aliphatic glucosinolate biosynthesis. DOI: 10.1073/pnas.0611629104 ; PMID: 17420480
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- CressExpress: a tool for large-scale mining of expression data from Arabidopsis. DOI: 10.1104/pp.107.115535 ; PMID: 18467456
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Karrikins enhance light responses during germination and seedling development in Arabidopsis thaliana. DOI: 10.1073/pnas.0911635107 ; PMID: 20351290
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- Identification of proteins enriched in rice egg or sperm cells by single-cell proteomics. DOI: 10.1371/journal.pone.0069578 ; PMID: 23936051
- Potential Arabidopsis thaliana glucosinolate genes identified from the co-expression modules using graph clustering approach. DOI: 10.7717/peerj.11876 ; PMID: 34430080
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequences:
cDNA Sequence
- >AT5G07460.1
TGATCTAAATAATTTCAGACCAACCAATTTTTTTGAATTATGTTTCCAAATTATAATGATGGTTGTTGGATTTTTTTTTTAAATAGATAGTTGATACAGTATTTCTATATACAATAAAAGAAATGACGCGTAATATATCCATTATTCATTAACAATTTGACCAAATTATAAATGCTACACATAGTATTGATTGAATGTATTTTTCTTGTGTGTCAAATACTACTTACATTGAAATATGAATATTCCTATTTAGCGATGATTTTTAGGTGTTAATCTCTGACTAGCTTCTTTATATATATAAACGAGCTTCCCGAGGTCTCATCATCAAACAATACACTTAACAATGGATTCTTCTCTGAAAACTCAGGAACCTCAAGTAGTGGAAACTTCTCCTTCTCCGGTAGCTCAGGAGCCTCCTCAAGTAGCTGACAAACCTGCGATTGTTCCTTCTCCGATAGCTCAAGAGCCAGACAACGATGTTCCGGCGCCGGGAAACGAGTTTGCTGAGTTCGCCGCCGGTTGTTTCTGGGGAGTGGAGCTTGCTTTCCAGAGAATCCCTGGCGTGACCGTGACTGAGGTCGGTTACACTCATGGGATCTCTCACAATCCGTCTTATGAAGATGTCTGTACGAACACCACGAACCATGCAGAAGTTGTCAGGGTTCAATATGATCCTAAAGAATGCACTTATGAGACACTTCTTGATTTGTTTTGGTCTAGACATAATCCTACCACCTTGAATCGTCAGGGAGAACTTTTGGGAGCACAATACCGATCAGGTATATATTTCTACACACCGGAGCAAGAGAAACTAGCACGCGAGTCTCTAGAGAAAGAGCAGAAAAAACTGGAGGATAAGATTGTGACTGAGATCTTACCGGCAAAGAAATTCTACAAAGCTGAAGAATACCATCAGCAGTACCTTGTCAAAGGTGGGATGCATGGAAACGCTCAATCACCTGCAAAGAGCTGCAAGGACCCTATCCGCTGCTATGGCTAATCAAAAGCCTTTGTTCCTCTTCTCCCAAAACAGAGGATTCTCCCAGAGGACCTCTTTACCTGTTGCTTTGTTGGTTTGTGTGTGTGCGTGTGTTTATATGTACTTGTCATCTCATCATACATAATAAAAGATGTGGGATCATCTCACCTTTGTGAAATTCTTTTCGTTACTCCAAATTCAACTAATAAATATTTGAATAAGTCATTAGTACTCC
CDS Sequence
Protein Sequence