Information report for AT5G07200
Gene Details
|
|
Functional Descriptions
- PO:0009001 — fruit — frucht (exact, German), fruto (exact, Spanish), 果実 (exact, Japanese), coenocarp (narrow), syncarp (narrow), aggregate fruit (broad), compound fruit (broad), dehiscent fruit (broad), diaspore (broad), indehiscent fruit (broad), multiple fruit (broad), propagule (broad)
- PO:0009010 — seed — semilla (Spanish, exact), 種子 (Japanese, exact), pyrene (narrow), diaspore (broad)
- PO:0020023 — plant ovule outer integument — integumento externo (Spanish, exact), 外珠皮 (Japanese, exact), Poaceae outer integument (narrow)
Functional Keywords
Literature and News
- Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis. DOI: 10.1104/pp.108.3.1049 ; PMID: 7630935
- Genome organization in Arabidopsis thaliana: a survey for genes involved in isoprenoid and chlorophyll metabolism. DOI: 10.1023/a:1023005504702 ; PMID: 12777052
- Gibberellin biosynthesis and response during Arabidopsis seed germination. DOI: 10.1105/tpc.011650 ; PMID: 12837949
- A genomic analysis of the shade avoidance response in Arabidopsis. DOI: 10.1104/pp.103.034397 ; PMID: 14645734
- Activation of gibberellin biosynthesis and response pathways by low temperature during imbibition of Arabidopsis thaliana seeds. DOI: 10.1105/tpc.018143 ; PMID: 14729916
- The involvement of gibberellin 20-oxidase genes in phytochrome-regulated petiole elongation of Arabidopsis. DOI: 10.1104/pp.104.059055 ; PMID: 15923331
- Contribution of gibberellins to the formation of Arabidopsis seed coat through starch degradation. DOI: 10.1093/pcp/pci141 ; PMID: 15927942
- Overexpression of ADC2 in Arabidopsis induces dwarfism and late-flowering through GA deficiency. DOI: 10.1111/j.1365-313X.2005.02465.x ; PMID: 16045477
- Characterization of a novel putative zinc finger gene MIF1: involvement in multiple hormonal regulation of Arabidopsis development. DOI: 10.1111/j.1365-313X.2005.02626.x ; PMID: 16412086
- Gene expression profiles of Arabidopsis Cvi seeds during dormancy cycling indicate a common underlying dormancy control mechanism. DOI: 10.1111/j.1365-313X.2006.02738.x ; PMID: 16709196
- GA4 is the active gibberellin in the regulation of LEAFY transcription and Arabidopsis floral initiation. DOI: 10.1105/tpc.106.042317 ; PMID: 16920780
- Regulation of hormone metabolism in Arabidopsis seeds: phytochrome regulation of abscisic acid metabolism and abscisic acid regulation of gibberellin metabolism. DOI: 10.1111/j.1365-313X.2006.02881.x ; PMID: 17010113
- High temperature-induced abscisic acid biosynthesis and its role in the inhibition of gibberellin action in Arabidopsis seeds. DOI: 10.1104/pp.107.113738 ; PMID: 18162586
- Elucidating the germination transcriptional program using small molecules. DOI: 10.1104/pp.107.110841 ; PMID: 18359847
- Transcriptional factor interaction: a central step in DELLA function. DOI: 10.1016/j.gde.2008.05.004 ; PMID: 18590820
- Evolutionary analysis of three gibberellin oxidase genes in rice, Arabidopsis, and soybean. DOI: 10.1016/j.gene.2010.10.010 ; PMID: 21056641
- Interplay between ABA and GA Modulates the Timing of Asymmetric Cell Divisions in the Arabidopsis Root Ground Tissue. DOI: 10.1016/j.molp.2016.02.009 ; PMID: 26970019
- Gibberellins are involved in effect of near-null magnetic field on Arabidopsis flowering. DOI: 10.1002/bem.22004 ; PMID: 27598690
- PIL5 represses floral transition in Arabidopsis under long day conditions. DOI: 10.1016/j.bbrc.2018.03.179 ; PMID: 29588173
- AtPER1 enhances primary seed dormancy and reduces seed germination by suppressing the ABA catabolism and GA biosynthesis in Arabidopsis seeds. DOI: 10.1111/tpj.14542 ; PMID: 31536657
- Histone Deacetylases Regulate MORE AXILLARY BRANCHED 2-Dependent Germination of Arabidopsis thaliana. DOI: 10.1093/pcp/pcad047 ; PMID: 37279553
- The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression. DOI: 10.1073/pnas.92.14.6640 ; PMID: 7604047
- The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle. DOI: 10.1111/j.1365-313X.2007.03356.x ; PMID: 18069939
Gene Resources
- UniProt: A0A654FZ64
- EMBL: CACRSJ010000110
- AlphaFoldDB: A0A654FZ64
- EnsemblPlants: AT5G07200.1
- Gramene: AT5G07200.1
- KEGG: ath:AT5G07200
- Orthologous matrix: CKEMNRL
- ExpressionAtlas: AT5G07200
- InterPro: IPR005123, IPR026992, IPR027443
- PANTHER: PTHR47990
- SUPFAM: SSF51197
- PROSITE: PS51471
- Gene3D: 2.60.120.330
- SWISS-MODEL: A0A654FZ64
Sequences
cDNA Sequence
- >AT5G07200.1
CCCAAATGCCGCTTACGTACTATTCCCTGCACCTAAGTTTCCCTCTCGCACCTATATATACCACTCCTTTCCTCTCCCACTTACCGACCACTGTACTGAATCTTTAAGCCTCTCAACGTGTTTTTTATATATATTTTGAAAATCTTTTACGCCTTAAAAGGATCTACGATAATTAAAAAAAAATGGCAACGGAATGCATTGCAACGGTCCCTCAAATATTCAGTGAAAACAAAACCAAAGAGGATTCTTCGATCTTCGATGCAAAGCTCCTTAATCAGCACTCGCACCACATACCTCAACAGTTCGTATGGCCCGACCACGAGAAACCTTCTACGGATGTTCAACCTCTCCAAGTCCCACTCATAGACCTAGCCGGTTTCCTCTCCGGCGACTCGTGCTTGGCATCGGAGGCTACTAGACTCGTCTCAAAGGCTGCAACGAAACATGGCTTCTTCCTAATCACTAACCATGGTGTCGATGAGAGCCTCTTGTCTCGTGCCTATCTGCATATGGACTCTTTCTTTAAGGCCCCGGCTTGTGAGAAGCAGAAGGCTCAGAGGAAGTGGGGTGAGAGCTCCGGTTACGCTAGTAGTTTCGTCGGGAGATTCTCCTCAAAGCTCCCGTGGAAGGAGACTCTGTCGTTTAAGTTCTCTCCCGAGGAGAAGATCCATTCCCAAACCGTTAAAGACTTTGTTTCTAAGAAAATGGGCGATGGATACGAAGATTTCGGGAAGGTTTATCAAGAATACGCGGAGGCCATGAACACTCTCTCACTAAAGATCATGGAGCTTCTTGGAATGAGTCTTGGGGTCGAGAGGAGATATTTTAAAGAGTTTTTCGAAGACAGCGATTCAATATTCCGGTTGAATTACTACCCGCAGTGCAAGCAACCGGAGCTTGCACTAGGGACAGGACCCCACTGCGACCCAACATCTCTAACCATACTTCATCAAGACCAAGTTGGCGGTCTGCAAGTTTTCGTGGACAACAAATGGCAATCCATTCCTCCTAACCCTCACGCTTTCGTGGTGAACATAGGCGACACCTTCATGGCTCTAACGAATGGAAGATACAAGAGTTGTTTGCATCGGGCGGTGGTGAACAGCGAGAGAGAAAGGAAGACGTTTGCATTCTTCCTATGTCCGAAAGGGGAAAAAGTGGTGAAGCCACCAGAAGAACTAGTAAACGGAGTGAAGTCTGGTGAAAGAAAGTATCCTGATTTTACGTGGTCTATGTTTCTTGAGTTCACACAGAAGCATTATAGGGCAGACATGAACACTCTTGACGAGTTCTCAATTTGGCTTAAGAACAGAAGAAGTTTCTAAAATTGAGGAGACAATGTTGTGGTCCAGAAGGTCACTTGTAGTTATGTATAGAGCTTTCACTGTTTTTCTTAAGATGTTCAAGACTTGTTAAGGATCGGAGACTTTTTTGTTCTTTTATTATCTTGCTCTAGGTTGTCTGGTGTTAAATAAAAGTAGCAAAAAAATAAAAATATATGTACTCCATTGGGTCTACTTATGATTTGTTTCGAAATGGTTTTTTTATAGTCTCTAATGTTAAATTTATGTCACTATTACTATTATTAAATGAAGTTTATCAAGTAC
CDS Sequence
Protein Sequence