Gene Details:
- Gene ID: AT5G06860
- Gene Symbol: ATPGIP1, PGIP1
- Gene Name: POLYGALACTURONASE INHIBITING PROTEIN 1, polygalacturonase inhibiting protein 1
- Description: polygalacturonase inhibiting protein 1;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Function-related keywords:
Literature:
- The leucine-rich repeat as a protein recognition motif. DOI: 10.1016/s0959-440x(01)00266-4 ; PMID: 11751054
- Systemic gene expression in Arabidopsis during an incompatible interaction with Alternaria brassicicola. DOI: 10.1104/pp.103.021683 ; PMID: 12805628
- Proteomics of loosely bound cell wall proteins of Arabidopsis thaliana cell suspension cultures: a critical analysis. DOI: 10.1002/elps.200305608 ; PMID: 14595688
- Selective and powerful stress gene expression in Arabidopsis in response to malondialdehyde. DOI: 10.1111/j.1365-313x.2003.02013.x ; PMID: 14996219
- Transcript profiling in Arabidopsis reveals complex responses to global inhibition of DNA methylation and histone deacetylation. DOI: 10.1074/jbc.M409053200 ; PMID: 15516340
- A proteomic approach to apoplastic proteins involved in cell wall regeneration in protoplasts of Arabidopsis suspension-cultured cells. DOI: 10.1093/pcp/pci089 ; PMID: 15769804
- Floral gene resources from basal angiosperms for comparative genomics research. DOI: 10.1186/1471-2229-5-5 ; PMID: 15799777
- Detoxification and transcriptome response in Arabidopsis seedlings exposed to the allelochemical benzoxazolin-2(3H)-one. DOI: 10.1074/jbc.M500694200 ; PMID: 15824099
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Phytotoxicity and innate immune responses induced by Nep1-like proteins. DOI: 10.1105/tpc.106.044180 ; PMID: 17194768
- An integrated view of gene expression and solute profiles of Arabidopsis tumors: a genome-wide approach. DOI: 10.1105/tpc.106.044743 ; PMID: 17172353
- A hormone and proteome approach to picturing the initial metabolic events during Plasmodiophora brassicae infection on Arabidopsis. DOI: 10.1094/MPMI-19-1431 ; PMID: 17153927
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptional responses of Arabidopsis thaliana plants to As (V) stress. DOI: 10.1186/1471-2229-8-87 ; PMID: 18684332
- A new picture of cell wall protein dynamics in elongating cells of Arabidopsis thaliana: confirmed actors and newcomers. DOI: 10.1186/1471-2229-8-94 ; PMID: 18796151
- A peroxisomal ABC transporter promotes seed germination by inducing pectin degradation under the control of ABI5. DOI: 10.1111/j.1365-313X.2010.04205.x ; PMID: 20345608
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- Iron-dependent modifications of the flower transcriptome, proteome, metabolome, and hormonal content in an Arabidopsis ferritin mutant. DOI: 10.1093/jxb/ert112 ; PMID: 23682113
- and low pH-tolerance that are regulated by STOP1 in Arabidopsis. DOI: 10.1093/mp/sst116 ; PMID: 23935008
- Expression GWAS of PGIP1 Identifies STOP1-Dependent and STOP1-Independent Regulation of PGIP1 in Aluminum Stress Signaling in Arabidopsis. DOI: 10.3389/fpls.2021.774687 ; PMID: 34975956
- The leucine-rich repeat as a protein recognition motif. DOI: 10.1016/s0959-440x(01)00266-4 ; PMID: 11751054
- Proteomics of loosely bound cell wall proteins of Arabidopsis thaliana cell suspension cultures: a critical analysis. DOI: 10.1002/elps.200305608 ; PMID: 14595688
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
- Identification by 2-D DIGE of apoplastic proteins regulated by oligogalacturonides in Arabidopsis thaliana. DOI: 10.1002/pmic.200700523 ; PMID: 18324730
- Analysis of the Arabidopsis cytosolic proteome highlights subcellular partitioning of central plant metabolism. DOI: 10.1021/pr1009433 ; PMID: 21166475
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequences:
cDNA Sequence
- >AT5G06860.1
CATCAAAATTCAAAACCAACACCATGGATAAGACAGCGACATTGTGTCTCTTGTTCTTGTTCACATTCCTCACGACCTGTTTGTCTAAAGATCTCTGTAACCAAAATGACAAAAACACCCTCCTCAAGATCAAGAAATCTCTAAACAACCCTTATCACCTCGCTTCATGGGACCCTCAAACCGACTGTTGCTCCTGGTACTGCCTTGAGTGCGGCGACGCCACCGTTAACCACCGTGTTACCGCCTTAACCATATTCTCCGGCCAGATCTCCGGTCAGATCCCGGCTGAAGTCGGTGACTTGCCGTATCTTGAGACCCTTGTCTTCCGCAAACTCTCTAACCTCACCGGTACAATCCAACCCACCATCGCCAAACTCAAGAACCTCCGAATGCTCAGGCTCAGCTGGACGAATCTGACAGGTCCAATTCCTGACTTTATAAGTCAGCTCAAGAATCTCGAGTTCTTAGAACTTTCCTTCAATGATCTCTCTGGTTCCATTCCAAGTTCTCTCTCTACGTTACCTAAAATCTTGGCTCTTGAACTTAGCAGGAACAAACTTACAGGTTCCATACCAGAGTCATTTGGGTCGTTTCCAGGAACAGTCCCTGACCTTCGCCTATCACATAACCAGCTCTCCGGTCCAATACCCAAATCATTAGGCAACATCGACTTTAACCGGATCGATTTATCCCGCAACAAGCTCCAAGGTGATGCTTCGATGTTGTTTGGTTCCAACAAAACAACCTGGTCTATTGACTTATCAAGAAACATGTTCCAGTTCGATATCTCAAAGGTTGATATCCCTAAAACACTTGGTATCTTGGACTTGAACCACAATGGGATCACTGGGAATATTCCGGTGCAGTGGACTGAAGCTCCTCTTCAGTTCTTCAATGTTAGCTACAACAAACTGTGTGGACACATCCCAACTGGAGGGAAACTTCAGACATTTGATTCTTATTCCTATTTTCACAACAAGTGTTTGTGTGGTGCTCCTCTTGAAATTTGCAAGTAAACCAAGCTTATCTCTAGGATTACGAAAAAATATATTTGAGTCAATAATATAGACAAATATGTAATGTTATTCGGATTGATTAATAAAACATGAACCAAACCTCTCATTTGATGTATTCATAGCACATTTTCAAAATGTTTTATTTGATGGATT
CDS Sequence
Protein Sequence