Gene Details:
- Gene ID: AT5G05770
- Gene Symbol: WOX5A, WOX7
- Gene Name: WUSCHEL related homeobox 5A, WUSCHEL related homeobox 7
- Description: WUSCHEL related homeobox 7;(source:Araport11)
- TAIR Accession: locus:2166434
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000060 — root cortex-endodermis initial cell — célula inicial del cortex/endodermis de la raíz (Spanish, exact), root cortex-endodermis initial (exact), root cortex-endodermis stem cell (exact), 根皮層内皮始原細胞 (Japanese, exact)
- PO:0020127 — primary root — raíz primaria (Spanish, exact), tap root (exact), 一次根 (Japanese, exact)
Gene Ontology:
- GO:0006355 — acts upstream of or within — regulation of DNA-templated transcription
- GO:0005634 — located in — nucleus
- GO:0003700 — enables — DNA-binding transcription factor activity
Function-related keywords:
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Rapid identification of Arabidopsis insertion mutants by non-radioactive detection of T-DNA tagged genes. DOI: 10.1046/j.1365-313x.2002.01416.x ; PMID: 12383089
- Expression dynamics of WOX genes mark cell fate decisions during early embryonic patterning in Arabidopsis thaliana. DOI: 10.1242/dev.00963 ; PMID: 14711878
- Phylogenomics of plant genomes: a methodology for genome-wide searches for orthologs in plants. DOI: 10.1186/1471-2164-9-183 ; PMID: 18426584
- TDIF peptide signaling regulates vascular stem cell proliferation via the WOX4 homeobox gene in Arabidopsis. DOI: 10.1105/tpc.110.076083 ; PMID: 20729381
- Genome-wide analysis of WOX gene family in rice, sorghum, maize, Arabidopsis and poplar. DOI: 10.1111/j.1744-7909.2010.00982.x ; PMID: 20977659
- Genome-wide direct target analysis reveals a role for SHORT-ROOT in root vascular patterning through cytokinin homeostasis. DOI: 10.1104/pp.111.183178 ; PMID: 21951467
- The WUSCHEL Related Homeobox Protein WOX7 Regulates the Sugar Response of Lateral Root Development in Arabidopsis thaliana. DOI: 10.1016/j.molp.2015.11.006 ; PMID: 26621542
- ETHYLENE INSENSITIVE 3 suppresses plant de novo root regeneration from leaf explants and mediates age-regulated regeneration decline. DOI: 10.1242/dev.179457 ; PMID: 32291272
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
Sequences:
cDNA Sequence
- >AT5G05770.1
TATAACATATCCAAAACCCTAAAACGCAAACACTAAGATAACTATTTCTTGAAATTAATAATGTCGTCGAGAGGATTCAACATTAAAGCTAGAGGATTATGTAATAACAACAACGGAGGAGGAGGAACGGGGGCGAAGTGTGGACGGTGGAATCCAACGGTGGAGCAAGTGAAGCTTCTGACAGATCTGTTCAAGGCGGGACTGCGAACACCGAGCACGGACCAGATTCAGAAGATCTCTATGGAGCTGAGTTTCTACGGTAAGATTGAGAGCAAGAACGTGTTCTATTGGTTCCAAAACCATAAAGCTAGAGAGAGACAAAAGTGCCGGAAAATCTCCACCGTCAAGTTTGATCATCGTCAAGATACAGATCTTTCTAAGCCTCGCCGAGACAACGTACGTCGTCATCAACTACCAGCGAAAGGTTAA
CDS Sequence
Protein Sequence