Information report for AT5G05440
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Functional Keywords
Literature and News
- Identification of unstable transcripts in Arabidopsis by cDNA microarray and specific clock-controlled genes. DOI: 10.1073/pnas.152204099 ; PMID: 12167669
- A two-step strategy for detecting differential gene expression in cDNA microarray data. DOI: 10.1007/s00294-004-0551-3 ; PMID: 15688252
- and darkness-regulated Arabidopsis genes: a focus on calmodulin-like and XTH genes. DOI: 10.1111/j.1469-8137.2004.01238.x ; PMID: 15720654
- Cuticular lipid composition, surface structure, and gene expression in Arabidopsis stem epidermis. DOI: 10.1104/pp.105.070805 ; PMID: 16299169
- Transcriptome analysis of Arabidopsis clubroots indicate a key role for cytokinins in disease development. DOI: 10.1094/MPMI-19-0480 ; PMID: 16673935
- Regulators of PP2C phosphatase activity function as abscisic acid sensors. DOI: 10.1126/science.1172408 ; PMID: 19407143
- Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. DOI: 10.1126/science.1173041 ; PMID: 19407142
- Modulation of drought resistance by the abscisic acid receptor PYL5 through inhibition of clade A PP2Cs. DOI: 10.1111/j.1365-313X.2009.03981.x ; PMID: 19624469
- PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis. DOI: 10.1111/j.1365-313X.2009.04054.x ; PMID: 19874541
- Crystallization of the plant hormone receptors PYL9/RCAR1, PYL5/RCAR8 and PYR1/RCAR11 in the presence of (+)-abscisic acid. DOI: 10.1107/S1744309110007037 ; PMID: 20383021
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- Jasmonate signaling involves the abscisic acid receptor PYL4 to regulate metabolic reprogramming in Arabidopsis and tobacco. DOI: 10.1073/pnas.1103010108 ; PMID: 21436041
- Global gene expression analysis of transgenic, mannitol-producing, and salt-tolerant Arabidopsis thaliana indicates widespread changes in abiotic and biotic stress-related genes. DOI: 10.1093/jxb/err130 ; PMID: 21821598
- Identification of an important site for function of the type 2C protein phosphatase ABI2 in abscisic acid signalling in Arabidopsis. DOI: 10.1093/jxb/err274 ; PMID: 21885535
- Unique drought resistance functions of the highly ABA-induced clade A protein phosphatase 2Cs. DOI: 10.1104/pp.112.202408 ; PMID: 22829320
- The homeodomain-leucine zipper (HD-Zip) class I transcription factors ATHB7 and ATHB12 modulate abscisic acid signalling by regulating protein phosphatase 2C and abscisic acid receptor gene activities. DOI: 10.1007/s11103-012-9956-4 ; PMID: 22968620
- PYRABACTIN RESISTANCE1-LIKE8 plays an important role for the regulation of abscisic acid signaling in root. DOI: 10.1104/pp.112.208678 ; PMID: 23370718
- Structural insights into the abscisic acid stereospecificity by the ABA receptors PYR/PYL/RCAR. DOI: 10.1371/journal.pone.0067477 ; PMID: 23844015
- Constitutive production of nitric oxide leads to enhanced drought stress resistance and extensive transcriptional reprogramming in Arabidopsis. DOI: 10.1093/jxb/eru184 ; PMID: 24868034
- Conformationally restricted 3'-modified ABA analogs for controlling ABA receptors. DOI: 10.1039/c4ob02662d ; PMID: 25758810
- Lipoxygenase-derived 9-hydro(pero)xides of linoleoylethanolamide interact with ABA signaling to arrest root development during Arabidopsis seedling establishment. DOI: 10.1111/tpj.12821 ; PMID: 25752187
- The selectivity of 6-nor-ABA and 7'-nor-ABA for abscisic acid receptor subtypes. DOI: 10.1016/j.bmcl.2015.06.088 ; PMID: 26174552
- Overexpression of oligouridylate binding protein 1b results in ABA hypersensitivity. DOI: 10.1080/15592324.2017.1282591 ; PMID: 28112571
- Arabidopsis Transcription Factors SPL1 and SPL12 Confer Plant Thermotolerance at Reproductive Stage. DOI: 10.1016/j.molp.2017.03.010 ; PMID: 28400323
- The Arabidopsis Cys2/His2 zinc finger transcription factor ZAT18 is a positive regulator of plant tolerance to drought stress. DOI: 10.1093/jxb/erx157 ; PMID: 28586434
- Arabidopsis E3 Ubiquitin Ligases PUB22 and PUB23 Negatively Regulate Drought Tolerance by Targeting ABA Receptor PYL9 for Degradation. DOI: 10.3390/ijms18091841 ; PMID: 28837065
- Arabidopsis Duodecuple Mutant of PYL ABA Receptors Reveals PYL Repression of ABA-Independent SnRK2 Activity. DOI: 10.1016/j.celrep.2018.05.044 ; PMID: 29898403
- Optimized small-molecule pull-downs define MLBP1 as an acyl-lipid-binding protein. DOI: 10.1111/tpj.14272 ; PMID: 30735592
- Arabidopsis ALIX Regulates Stomatal Aperture and Turnover of Abscisic Acid Receptors. DOI: 10.1105/tpc.19.00399 ; PMID: 31363038
- The role of Arabidopsis ABA receptors from the PYR/PYL/RCAR family in stomatal acclimation and closure signal integration. DOI: 10.1038/s41477-019-0490-0 ; PMID: 31451795
- FRET kinase sensor development reveals SnRK2/OST1 activation by ABA but not by MeJA and high CO(2) during stomatal closure. DOI: 10.7554/eLife.56351 ; PMID: 32463362
- Abscisic acid receptors maintain abscisic acid homeostasis by modulating UGT71C5 glycosylation activity. DOI: 10.1111/jipb.13030 ; PMID: 33205908
- New Abscisic Acid Derivatives Revealed Adequate Regulation of Stomatal, Transcriptional, and Developmental Responses to Conquer Drought. DOI: 10.1021/acschembio.1c00451 ; PMID: 34379974
- BAK1 plays contrasting roles in regulating abscisic acid-induced stomatal closure and abscisic acid-inhibited primary root growth in Arabidopsis. DOI: 10.1111/jipb.13257 ; PMID: 35352463
- BIC2, a Cryptochrome Function Inhibitor, Is Involved in the Regulation of ABA Responses in Arabidopsis. DOI: 10.3390/plants12112220 ; PMID: 37299199
Gene Resources
- UniProt: A0A5S9Y1M7
- EMBL: CACRSJ010000110, CACSHJ010000096, LR881470
- AlphaFoldDB: A0A5S9Y1M7
- EnsemblPlants: AT5G05440.1
- Gramene: AT5G05440.1
- KEGG: ath:AT5G05440
- Orthologous matrix: ARCPRET
- ExpressionAtlas: AT5G05440
- InterPro: IPR019587, IPR023393, IPR050279
- PANTHER: PTHR31213, PTHR31213:SF183
- SUPFAM: SSF55961
- Gene3D: 3.30.530.20
- OrthoDB: A0A5S9Y1M7
- SWISS-MODEL: A0A5S9Y1M7
- Conserved Domain Database: cd07821
Sequences
cDNA Sequence
- >AT5G05440.1
AGGAAAGAAATCATGGGGGCATAAGATGGTACAATGTATCATACATGGTCACACACATCTATATGATACAAATGCGTCTATATACACAACTGTTTCTATATACATACAAACACAAAGCCTTCACATCCCCAGCTATCTCTATCCATCTATCTTCAAATATATATTTTTAAAAACACACAATGTTCATATCTTATTGTTATTGTTATAAAATAAAAGATGATCATACTTTTTAAATTTCTCAAACAAAACCAACTTGACAACCGACAGCGAACAAGATCAAAAAGCTAGCTCTCTTCTTTTCTCATCAAACTTATTTCTCTCTCGATCGCAATATATACGATTCCATAAATTCTCCCAAAAACAAATTAAGAGATAGAGGAGAGATCATGAGGTCACCGGTGCAACTCCAACACGGCTCAGACGCCACTAACGGTTTCCACACGCTGCAGCCTCACGATCAGACCGATGGTCCGATCAAGAGAGTGTGTCTCACGCGCGGTATGCATGTCCCTGAACACGTTGCGATGCACCACACACACGACGTTGGTCCGGACCAGTGTTGCTCCTCGGTGGTGCAGATGATCCACGCGCCGCCTGAGTCCGTGTGGGCTCTTGTGCGGCGTTTCGATAATCCGAAGGTTTACAAGAACTTCATCAGACAGTGCCGTATCGTCCAAGGCGATGGACTACACGTCGGCGATCTCCGGGAGGTCATGGTGGTCTCTGGACTCCCGGCGGTCTCGAGCACCGAGAGGCTCGAGATCTTGGACGAGGAGCGTCACGTGATAAGCTTTAGTGTCGTTGGTGGGGACCACAGGCTCAAGAACTACCGATCGGTGACGACACTACACGCGTCGGACGACGAAGGTACCGTGGTGGTGGAGTCTTACATCGTTGATGTGCCGCCGGGAAACACGGAGGAGGAAACTCTAAGCTTCGTTGATACTATCGTCCGGTGCAACCTTCAGTCTCTGGCTCGAAGTACCAACCGGCAATAATCTCATCTTTCTTATATAAATTGCAATTATGTATCTAATTTTTTTTGTTGTTCTATTTCTTTTAGATGTTCGATCTTCTTTACAAGGAAGAAAATTTCGAGTACCTTTTCTTTCTTTTTAAATAGATATATCGGCTTAGAAAGAATTGTAATTTAATGGGGATTTCTTTGGGAGATTTATGTTGGAAATTTCGAAGTACTGTTGGGGGATTCACAAAACTTTGGATTTGGAGGGTGTTAGTACTGGTACATAAAACATTTTAAGGTGAATCTGTTAAATGAATTAATCCATTTGTTGTTTTGTACATGGTATCATTCTTTGTGACATTGTTTAATTTCTTGTACTCTTTTAAATGTTACTCTTAACCGTTTTTTTCTTTTGTGGTTTGTAAATGAATATTTGATGCATCGGTATTGTTAATGATAGACTTATTAATTTATTTCTTCATAGTATGTAACATTACTATAAGTTTGTTTTTTGTTGGTTGATCCTTGTGTCCAAATGTTCTAAATAGAAAATATAATACAAAGCCGATATTCTGA
CDS Sequence
Protein Sequence