Information report for AT5G05410
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Functional Keywords
Literature and News
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The sfr6 mutant of Arabidopsis is defective in transcriptional activation via CBF/DREB1 and DREB2 and shows sensitivity to osmotic stress. DOI: 10.1046/j.1365-313x.2003.01734.x ; PMID: 12753580
- Genome-wide analysis of gene expression reveals function of the bZIP transcription factor HY5 in the UV-B response of Arabidopsis. DOI: 10.1073/pnas.0308044100 ; PMID: 14739338
- Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression. DOI: 10.1105/tpc.105.035881 ; PMID: 16617101
- Gene expression profiles during heat acclimation in Arabidopsis thaliana suspension-culture cells. DOI: 10.1007/s10265-006-0285-z ; PMID: 16807682
- The Arabidopsis tetratricopeptide repeat-containing protein TTL1 is required for osmotic stress responses and abscisic acid sensitivity. DOI: 10.1104/pp.106.085191 ; PMID: 16998088
- Dual function of an Arabidopsis transcription factor DREB2A in water-stress-responsive and heat-stress-responsive gene expression. DOI: 10.1073/pnas.0605639103 ; PMID: 17030801
- Overexpression of an R1R2R3 MYB gene, OsMYB3R-2, increases tolerance to freezing, drought, and salt stress in transgenic Arabidopsis. DOI: 10.1104/pp.106.094532 ; PMID: 17293435
- Regulation and functional analysis of ZmDREB2A in response to drought and heat stresses in Zea mays L. DOI: 10.1111/j.1365-313X.2007.03034.x ; PMID: 17346263
- STRESS RESPONSE SUPPRESSOR1 and STRESS RESPONSE SUPPRESSOR2, two DEAD-box RNA helicases that attenuate Arabidopsis responses to multiple abiotic stresses. DOI: 10.1104/pp.107.099895 ; PMID: 17556511
- Functional analysis of AHK1/ATHK1 and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis. DOI: 10.1073/pnas.0706547105 ; PMID: 18077346
- Identification of a novel cis-regulatory element for UV-B-induced transcription in Arabidopsis. DOI: 10.1111/j.1365-313X.2008.03435.x ; PMID: 18266923
- Soybean WRKY-type transcription factor genes, GmWRKY13, GmWRKY21, and GmWRKY54, confer differential tolerance to abiotic stresses in transgenic Arabidopsis plants. DOI: 10.1111/j.1467-7652.2008.00336.x ; PMID: 18384508
- Arabidopsis DREB2A-interacting proteins function as RING E3 ligases and negatively regulate plant drought stress-responsive gene expression. DOI: 10.1105/tpc.107.057380 ; PMID: 18552202
- Two cysteine proteinase inhibitors from Arabidopsis thaliana, AtCYSa and AtCYSb, increasing the salt, drought, oxidation and cold tolerance. DOI: 10.1007/s11103-008-9357-x ; PMID: 18523728
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Metabolic pathways involved in cold acclimation identified by integrated analysis of metabolites and transcripts regulated by DREB1A and DREB2A. DOI: 10.1104/pp.109.135327 ; PMID: 19502356
- TaCHP: a wheat zinc finger protein gene down-regulated by abscisic acid and salinity stress plays a positive role in stress tolerance. DOI: 10.1104/pp.110.161182 ; PMID: 20639406
- A subcellular localization compendium of hydrogen peroxide-induced proteins. DOI: 10.1111/j.1365-3040.2011.02323.x ; PMID: 21443605
- WRKY transcription factors: key components in abscisic acid signalling. DOI: 10.1111/j.1467-7652.2011.00634.x ; PMID: 21696534
- Cloning and characterization of a maize SnRK2 protein kinase gene confers enhanced salt tolerance in transgenic Arabidopsis. DOI: 10.1007/s00299-011-1077-z ; PMID: 21638061
- Arabidopsis HsfA1 transcription factors function as the main positive regulators in heat shock-responsive gene expression. DOI: 10.1007/s00438-011-0647-7 ; PMID: 21931939
- An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis. DOI: 10.1093/pcp/pcr143 ; PMID: 22025559
- Enhanced Y1H assays for Arabidopsis. DOI: 10.1038/nmeth.1750 ; PMID: 22037706
- RCD1-DREB2A interaction in leaf senescence and stress responses in Arabidopsis thaliana. DOI: 10.1042/BJ20111739 ; PMID: 22150398
- Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. DOI: 10.1111/j.1365-3040.2012.02480.x ; PMID: 22220579
- JUNGBRUNNEN1, a reactive oxygen species-responsive NAC transcription factor, regulates longevity in Arabidopsis. DOI: 10.1105/tpc.111.090894 ; PMID: 22345491
- Interactions between DNA, transcriptional regulator Dreb2a and the Med25 mediator subunit from Arabidopsis thaliana involve conformational changes. DOI: 10.1093/nar/gks265 ; PMID: 22447446
- AtPP2CG1, a protein phosphatase 2C, positively regulates salt tolerance of Arabidopsis in abscisic acid-dependent manner. DOI: 10.1016/j.bbrc.2012.05.064 ; PMID: 22627139
- γ-Aminobutyric acid transaminase deficiency impairs central carbon metabolism and leads to cell wall defects during salt stress in Arabidopsis roots. DOI: 10.1111/pce.12033 ; PMID: 23148892
- Homologous HAP5 subunit from Picea wilsonii improved tolerance to salt and decreased sensitivity to ABA in transformed Arabidopsis. DOI: 10.1007/s00425-013-1894-0 ; PMID: 23703145
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- Stabilization of Arabidopsis DREB2A is required but not sufficient for the induction of target genes under conditions of stress. DOI: 10.1371/journal.pone.0080457 ; PMID: 24376497
- Interaction studies of the human and Arabidopsis thaliana Med25-ACID proteins and plant-specific Dreb2a transcription factors. DOI: 10.1371/journal.pone.0098575 ; PMID: 24874105
- NADPH-dependent thioredoxin reductase A (NTRA) confers elevated tolerance to oxidative stress and drought. DOI: 10.1016/j.plaphy.2014.04.008 ; PMID: 24792388
- Promoter-based integration in plant defense regulation. DOI: 10.1104/pp.114.248716 ; PMID: 25352272
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- Arabidopsis DPB3-1, a DREB2A interactor, specifically enhances heat stress-induced gene expression by forming a heat stress-specific transcriptional complex with NF-Y subunits. DOI: 10.1105/tpc.114.132928 ; PMID: 25490919
- Identification of TaWD40D, a wheat WD40 repeat-containing protein that is associated with plant tolerance to abiotic stresses. DOI: 10.1007/s00299-014-1717-1 ; PMID: 25447637
- Reactive short-chain leaf volatiles act as powerful inducers of abiotic stress-related gene expression. DOI: 10.1038/srep08030 ; PMID: 25619826
- The Pepper Lipoxygenase CaLOX1 Plays a Role in Osmotic, Drought and High Salinity Stress Response. DOI: 10.1093/pcp/pcv020 ; PMID: 25657344
- AtUGT76C2, an Arabidopsis cytokinin glycosyltransferase is involved in drought stress adaptation. DOI: 10.1016/j.plantsci.2015.04.002 ; PMID: 26025529
- Arabidopsis Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Gene Raf43 Is Required for Tolerance to Multiple Abiotic Stresses. DOI: 10.1371/journal.pone.0133975 ; PMID: 26222830
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Ubiquitin Ligases RGLG1 and RGLG5 Regulate Abscisic Acid Signaling by Controlling the Turnover of Phosphatase PP2CA. DOI: 10.1105/tpc.16.00364 ; PMID: 27577789
- Transcriptional Regulation of Arabidopsis Polycomb Repressive Complex 2 Coordinates Cell-Type Proliferation and Differentiation. DOI: 10.1105/tpc.15.00744 ; PMID: 27650334
- The Arabidopsis UGT87A2, a stress-inducible family 1 glycosyltransferase, is involved in the plant adaptation to abiotic stresses. DOI: 10.1111/ppl.12520 ; PMID: 27747895
- A transcription factor hierarchy defines an environmental stress response network. DOI: 10.1126/science.aag1550 ; PMID: 27811239
- Structures and Short Linear Motif of Disordered Transcription Factor Regions Provide Clues to the Interactome of the Cellular Hub Protein Radical-induced Cell Death1. DOI: 10.1074/jbc.M116.753426 ; PMID: 27881680
- ABI5-binding proteins (AFPs) alter transcription of ABA-induced genes via a variety of interactions with chromatin modifiers. DOI: 10.1007/s11103-016-0569-1 ; PMID: 27942958
- Multifaceted role of cycling DOF factor 3 (CDF3) in the regulation of flowering time and abiotic stress responses in Arabidopsis. DOI: 10.1111/pce.12894 ; PMID: 28044345
- Vascular plant one-zinc-finger protein 2 is localized both to the nucleus and stress granules under heat stress in Arabidopsis. DOI: 10.1080/15592324.2017.1295907 ; PMID: 28277968
- Data for characterization of SALK_084889, a T-DNA insertion line of Arabidopsis thaliana. DOI: 10.1016/j.dib.2017.05.047 ; PMID: 28649584
- Arabidopsis EARLY FLOWERING3 increases salt tolerance by suppressing salt stress response pathways. DOI: 10.1111/tpj.13747 ; PMID: 29032592
- The E3 Ligase TaSAP5 Alters Drought Stress Responses by Promoting the Degradation of DRIP Proteins. DOI: 10.1104/pp.17.01319 ; PMID: 29089392
- Karrikin-KAI2 signalling provides Arabidopsis seeds with tolerance to abiotic stress and inhibits germination under conditions unfavourable to seedling establishment. DOI: 10.1111/nph.15192 ; PMID: 29726620
- ANAC019 is required for recovery of reproductive development under drought stress in Arabidopsis. DOI: 10.1007/s11103-018-0810-1 ; PMID: 30604322
- The Kinase CIPK11 Functions as a Negative Regulator in Drought Stress Response in Arabidopsis. DOI: 10.3390/ijms20102422 ; PMID: 31100788
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- Integrative Analysis from the Epigenome to Translatome Uncovers Patterns of Dominant Nuclear Regulation during Transient Stress. DOI: 10.1105/tpc.19.00463 ; PMID: 31519798
- A PXY-Mediated Transcriptional Network Integrates Signaling Mechanisms to Control Vascular Development in Arabidopsis. DOI: 10.1105/tpc.19.00562 ; PMID: 31806676
- Evolutionary conservation of the intrinsic disorder-based Radical-Induced Cell Death1 hub interactome. DOI: 10.1038/s41598-019-55385-3 ; PMID: 31831797
- induced AtAO3 differentially regulates plant defense and drought tolerance in Arabidopsis thaliana. DOI: 10.1186/s12870-019-2210-3 ; PMID: 31888479
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Genome-wide analysis of gene expression reveals function of the bZIP transcription factor HY5 in the UV-B response of Arabidopsis. DOI: 10.1073/pnas.0308044100 ; PMID: 14739338
- Genome-wide analysis of the ERF gene family in Arabidopsis and rice. DOI: 10.1104/pp.105.073783 ; PMID: 16407444
- Genome-wide analysis of the ERF gene family in Arabidopsis and rice. DOI: 10.1104/pp.105.073783 ; PMID: 16407444
Gene Resources
- UniProt: A0A7G2FAJ0
- EMBL: LR881470
- AlphaFoldDB: A0A7G2FAJ0
- EnsemblPlants: AT5G05410.1
- Gramene: AT5G05410.1
- KEGG: ath:AT5G05410
- Orthologous matrix: NGAYTHE
- ExpressionAtlas: AT5G05410
- InterPro: IPR001471, IPR016177, IPR036955
- PANTHER: PTHR31241, PTHR31241:SF37
- SUPFAM: SSF54171
- PROSITE: PS51032
- Gene3D: 3.30.730.10
- SWISS-MODEL: A0A7G2FAJ0
- Conserved Domain Database: cd00018
Sequences
cDNA Sequence
- >AT5G05410.1
AGATATTTTGATTTCTGCTAAAGCTGTCTGATAAAAAGAAGAGGAAAACTCGAAAAAGCTACACACAAGAAGAAGAAGAAAAGATACGAGCAAGAAGACTAAACACGAAAGCGATTTATCAACTCGAAGGAAGAGACTTTGATTTTCAAATTTCGTCCCCTATAGATTGTGTTGTTTCTGGGAAGGAGATGGCAGTTTATGATCAGAGTGGAGATAGAAACAGAACACAAATTGATACATCGAGGAAAAGGAAATCTAGAAGTAGAGGTGACGGTACTACTGTGGCTGAGAGATTAAAGAGATGGAAAGAGTATAACGAGACCGTAGAAGAAGTTTCTACCAAGAAGAGGAAAGTACCTGCGAAAGGGTCGAAGAAGGGTTGTATGAAAGGTAAAGGAGGACCAGAGAATAGCCGATGTAGTTTCAGAGGAGTTAGGCAAAGGATTTGGGGTAAATGGGTTGCTGAGATCAGAGAGCCTAATCGAGGTAGCAGGCTTTGGCTTGGTACTTTCCCTACTGCTCAAGAAGCTGCTTCTGCTTATGATGAGGCTGCTAAAGCTATGTATGGTCCTTTGGCTCGTCTTAATTTCCCTCGGTCTGATGCGTCTGAGGTTACGAGTACCTCAAGTCAGTCTGAGGTGTGTACTGTTGAGACTCCTGGTTGTGTTCATGTGAAAACAGAGGATCCAGATTGTGAATCTAAACCCTTCTCCGGTGGAGTGGAGCCGATGTATTGTCTGGAGAATGGTGCGGAAGAGATGAAGAGAGGTGTTAAAGCGGATAAGCATTGGCTGAGCGAGTTTGAACATAACTATTGGAGTGATATTCTGAAAGAGAAAGAGAAACAGAAGGAGCAAGGGATTGTAGAAACCTGTCAGCAACAACAGCAGGATTCGCTATCTGTTGCAGACTATGGTTGGCCCAATGATGTGGATCAGAGTCACTTGGATTCTTCAGACATGTTTGATGTCGATGAGCTTCTACGTGACCTAAATGGCGACGATGTGTTTGCAGGCTTAAATCAGGACCGGTACCCGGGGAACAGTGTTGCCAACGGTTCATACAGGCCCGAGAGTCAACAAAGTGGTTTTGATCCGCTACAAAGCCTCAACTACGGAATACCTCCGTTTCAGCTCGAGGGAAAGGATGGTAATGGATTCTTCGACGACTTGAGTTACTTGGATCTGGAGAACTAAACAAAACAATATGAAGCTTTTTGGATTTGATATTTGCCTTAATCCCACAACGACTGTTGATTCTCTATCCGAGTTTTAGTGATATAGAGAACTACAGAACACGTTTTTTCTTGTTATAAAGGTGAACTGTATATATCGAAACAGTGATATGACAATAGAGAAGACAACTATAGTTTGTTAGTCTGCTTCTCTTAAGTTGTTCTTTAGATATGTTTTATGTTTTGTAACAACAGGAATGAATAATACACACTTGTGAAGCTTTATGGGCCTTAGTGTGTCTCACAATATTTGAAATCGTAAGAGGAAAAACTATACGATCTCCACAAAAAAACTCATCATTGGATTGAGTCTTAGGAAGTTCTCTAGGGATTAGAGGGCAGCTTTATTTAACATTAAGCAGCTCGACATCAAAGACCAGCCAAGAGTCAGGGGGAATGCTACCAGCACCTTCCGCA - >AT5G05410.2
AGATATTTTGATTTCTGCTAAAGCTGTCTGATAAAAAGAAGAGGAAAACTCGAAAAAGCTACACACAAGAAGAAGAAGAAAAGATACGAGCAAGAAGACTAAACACGAAAGCGATTTATCAACTCGAAGGAAGAGACTTTGATTTTCAAATTTCGTCCCCTATAGATTGTGTTGTTTCTGGGAAGGAGATGGCAGTTTATGATCAGAGTGGAGATAGAAACAGAACACAAATTGATACATCGAGGAAAAGGAAATCTAGAAGTAGAGGTGACGGTACTACTGTGGCTGAGAGATTAAAGAGATGGAAAGAGTATAACGAGACCGTAGAAGAAGTTTCTACCAAGAAGAGGAAAGTACCTGCGAAAGGGTCGAAGAAGGGTTGTATGAAAGGTAAAGGAGGACCAGAGAATAGCCGATGTAGTTTCAGAGGAGTTAGGCAAAGGATTTGGGGTAAATGGGTTGCTGAGATCAGAGAGCCTAATCGAGGTAGCAGGCTTTGGCTTGGTACTTTCCCTACTGCTCAAGAAGCTGCTTCTGCTTATGATGAGGCTGCTAAAGCTATGTATGGTCCTTTGGCTCGTCTTAATTTCCCTCGGTCTGATGCGTCTGAGGTTACGAGTACCTCAAGTCAGTCTGAGGTGTGTACTGTTGAGACTCCTGGTTGTGTTCATGTGAAAACAGAGGATCCAGATTGTGAATCTAAACCCTTCTCCGGTGGAGTGGAGCCGATGTATTGTCTGGAGAATGGTGCGGAAGAGATGAAGAGAGGTGTTAAAGCGGATAAGCATTGGCTGAGCGAGTTTGAACATAACTATTGGAGTGATATTCTGAAAGAGAAAGAGAAACAGAAGGAGCAAGGGATTGTAGAAACCTGTCAGCAACAACAGCAGGATTCGCTATCTGTTGCAGACTATGGTTGGCCCAATGATGTGGATCAGAGTCACTTGGATTCTTCAGACATGTTTGATGTCGATGAGCTTCTACGTGACCTAAATGGCGACGATGTGTTTGCAGGCTTAAATCAGGACCGGTACCCGGGGAACAGTGTTGCCAACGGTTCATACAGGCCCGAGAGTCAACAAAGTGGTTTTGATCCGCTACAAAGCCTCAACTACGGAATACCTCCGTTTCAGCTCGAGGGAAAGGATGGTAATGGATTCTTCGACGACTTGAGTTACTTGGATCTGGAGAACTAAACAAAACAATATGAAGCTTTTTGGATTTGATATTTGCCTTAATCCCACAACGACTGTTGATTCTCTATCCGAGTTTTAGTGATATAGAGAACTACAGAACACGTTTTTTCTTGTTATAAAGGTGAACTGTATATATCGAAACAGTGATATGACAATAGAGAAGACAACTATAGTTTGTTAGTCTGCTTCTCTTAAGTTGTTCTTTAGATATGTTTTATGTTTTGTAACAACAGGAATGAATAATACACACTTGTGAAGCTTTATGGGCCTTAGTGTGTCTCACAATATTTGAAATCGTAAGAGGAAAAACTATACGATCTCCACAAAAAAACTCATCATTGGATTGAGTCTTAGGAAGTTCTCTAGGGATTAGAGGGCAGCTTTATTTAACATTAAGCAGCTCGACATCAAAGACCAGCCAAGAGTCAGGGGGAATGCTACCAGCACCTTCCGCA
CDS Sequence
Protein Sequence