Gene Details:
- Gene ID: AT5G05290
- Gene Symbol: ATEXP2, ATEXPA2, ATHEXP ALPHA 1.12, EXP2, EXPA2
- Gene Name: expansin A2, EXPANSIN 2, expansin A2
- Description: expansin A2;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Literature:
- Molecular cloning and sequence analysis of expansins–a highly conserved, multigene family of proteins that mediate cell wall extension in plants. DOI: 10.1073/pnas.92.20.9245 ; PMID: 7568110
- Expansins: ever-expanding numbers and functions. DOI: 10.1016/s1369-5266(00)00211-9 ; PMID: 11641069
- Plant expansins are a complex multigene family with an ancient evolutionary origin. DOI: 10.1104/pp.010658 ; PMID: 11891242
- The zinc-finger protein Zat12 plays a central role in reactive oxygen and abiotic stress signaling in Arabidopsis. DOI: 10.1104/pp.105.068254 ; PMID: 16183833
- Characterization of a novel putative zinc finger gene MIF1: involvement in multiple hormonal regulation of Arabidopsis development. DOI: 10.1111/j.1365-313X.2005.02626.x ; PMID: 16412086
- Overexpression of PRE1 and its homologous genes activates Gibberellin-dependent responses in Arabidopsis thaliana. DOI: 10.1093/pcp/pcj026 ; PMID: 16527868
- Gene expression profiles of Arabidopsis Cvi seeds during dormancy cycling indicate a common underlying dormancy control mechanism. DOI: 10.1111/j.1365-313X.2006.02738.x ; PMID: 16709196
- Expansins are involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2006.02856.x ; PMID: 16942607
- Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seed germination and floral development in Arabidopsis. DOI: 10.1104/pp.106.082289 ; PMID: 16920880
- Regulation of hormone metabolism in Arabidopsis seeds: phytochrome regulation of abscisic acid metabolism and abscisic acid regulation of gibberellin metabolism. DOI: 10.1111/j.1365-313X.2006.02881.x ; PMID: 17010113
- The Internal Glycine-Rich Motif and Cysteine Suppress Several Effects of the HpaG(Xooc) Protein in Plants. DOI: 10.1094/PHYTO-96-1052 ; PMID: 18943492
- AtEXP2 is involved in seed germination and abiotic stress response in Arabidopsis. DOI: 10.1371/journal.pone.0085208 ; PMID: 24404203
- A transcriptomics approach uncovers novel roles for poly(ADP-ribosyl)ation in the basal defense response in Arabidopsis thaliana. DOI: 10.1371/journal.pone.0190268 ; PMID: 29284022
- A Regulatory Module Controlling GA-Mediated Endosperm Cell Expansion Is Critical for Seed Germination in Arabidopsis. DOI: 10.1016/j.molp.2018.10.009 ; PMID: 30419294
- Light promotes jasmonate biosynthesis to regulate photomorphogenesis in Arabidopsis. DOI: 10.1007/s11427-019-1584-4 ; PMID: 31974860
- Molecular cloning and sequence analysis of expansins–a highly conserved, multigene family of proteins that mediate cell wall extension in plants. DOI: 10.1073/pnas.92.20.9245 ; PMID: 7568110
- Expansins: ever-expanding numbers and functions. DOI: 10.1016/s1369-5266(00)00211-9 ; PMID: 11641069
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
Sequences:
cDNA Sequence
- >AT5G05290.1
ACTACTCATCCCCTTTTCCACTTCTTACTTCCTCCTCTTTAGCCCATCAGCAAATATCATGAATCTTACAGAATATTCCCATATTTTGTTTCTTTCACTATGCACCCTCAACTTCTGCTTGTACTCCATAAACTCCGACGACAACGGAGGCTGGGAGAGAGGCCATGCTACCTTCTATGGTGGAGCTGATGCATCCGGCACAATGGGTGGTGCTTGTGGGTACGGTAACTTACACAGCCAAGGCTATGGGCTACAAACCGCGGCTTTGAGCACGGCTTTGTTCAATAGTGGGCAGAAATGTGGGGCCTGCTTTGAGCTACAGTGTGAGGATGATCCTGAGTGGTGCATCCCTGGTTCCATCATCGTCTCGGCTACAAACTTCTGTCCTCCAAACTTTGCCTTAGCTAATGATAATGGTGGTTGGTGCAATCCTCCTCTTAAGCACTTTGACTTGGCCGAGCCTGCCTTCCTCCAGATCGCTCAGTACCGAGCTGGGATCGTTCCTGTCGCATTCAGAAGGGTTCCATGTGAGAAAGGTGGAGGGATAAGGTTTACGATAAACGGGAATCCATATTTCGACCTCGTGCTAATCACGAATGTGGGTGGTGCTGGAGATATAAGGGCCGTCTCTTTGAAAGGCTCAAAGACAGATCAGTGGCAATCCATGTCAAGAAACTGGGGACAGAATTGGCAAAGCAACACTTACCTCAGAGGTCAAAGCCTTTCTTTCCAAGTCACTGATAGTGATGGTCGGACTGTTGTGAGCTACGATGTTGTGCCTCATGATTGGCAGTTCGGTCAGACTTTTGAAGGCGGACAATTTTAGATTTATGATCAAGTGAAACTAATAGACGTTATATCCAAGAAAAGTCAATGATTGTGTTTAAGATAAAACTCTGCTTTTCATTGATCATAACCACTCTTCGATATATAATAGTCATAAGAAAGAAATACAATGAAACAATTAATTTTGTTTGGAGATCATTTTGTATTCTTCGCATATCCTCGCTTAGTACAAAAGGTATCTCT
CDS Sequence
Protein Sequence