Information report for AT5G02490
Gene Details
|
|
Functional Descriptions
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Functional Keywords
Literature and News
- Genes encoding calmodulin-binding proteins in the Arabidopsis genome. DOI: 10.1074/jbc.M111626200 ; PMID: 11782485
- Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. DOI: 10.1104/pp.126.2.789 ; PMID: 11402207
- Diverse RNA viruses elicit the expression of common sets of genes in susceptible Arabidopsis thaliana plants. DOI: 10.1046/j.1365-313x.2003.01625.x ; PMID: 12535341
- Expression of an evolutionarily distinct novel BiP gene during the unfolded protein response in Arabidopsis thaliana. DOI: 10.1016/s0378-1119(03)00559-6 ; PMID: 12853141
- Comparative microarray analysis of Arabidopsis thaliana and Arabidopsis halleri roots identifies nicotianamine synthase, a ZIP transporter and other genes as potential metal hyperaccumulation factors. DOI: 10.1046/j.1365-313x.2003.01960.x ; PMID: 14690510
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Versatile gene-specific sequence tags for Arabidopsis functional genomics: transcript profiling and reverse genetics applications. DOI: 10.1101/gr.2544504 ; PMID: 15489341
- Combinatorial microarray analysis revealing arabidopsis genes implicated in cytokinin responses through the His->Asp Phosphorelay circuitry. DOI: 10.1093/pcp/pci033 ; PMID: 15695462
- Salicylic acid-dependent expression of host genes in compatible Arabidopsis-virus interactions. DOI: 10.1104/pp.104.056028 ; PMID: 15728340
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Proteomic analysis of differentially expressed proteins in fungal elicitor-treated Arabidopsis cell cultures. DOI: 10.1093/jxb/erj149 ; PMID: 16547123
- A comprehensive structure-function analysis of Arabidopsis SNI1 defines essential regions and transcriptional repressor activity. DOI: 10.1105/tpc.105.039677 ; PMID: 16766691
- Exploiting the wild crucifer Thlaspi arvense to identify conserved and novel genes expressed during a plant's response to cold stress. DOI: 10.1007/s11103-006-9080-4 ; PMID: 16972165
- Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. DOI: 10.1105/tpc.107.051896 ; PMID: 18065690
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Arabidopsis AAL-toxin-resistant mutant atr1 shows enhanced tolerance to programmed cell death induced by reactive oxygen species. DOI: 10.1016/j.bbrc.2008.08.056 ; PMID: 18725200
- Changes in the gene expression profile of Arabidopsis thaliana after infection with Tobacco etch virus. DOI: 10.1186/1743-422X-5-92 ; PMID: 18684336
- Transcriptional profiling of pea ABR17 mediated changes in gene expression in Arabidopsis thaliana. DOI: 10.1186/1471-2229-8-91 ; PMID: 18783601
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Genomic analysis of the Hsp70 superfamily in Arabidopsis thaliana. DOI: 10.1379/1466-1268(2001)006<0201:gaoths>2.0.co;2 ; PMID: 11599561
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- AtHsp70-15-deficient Arabidopsis plants are characterized by reduced growth, a constitutive cytosolic protein response and enhanced resistance to TuMV. DOI: 10.1111/j.1365-313X.2011.04558.x ; PMID: 21418353
- The Mediator complex in plants: structure, phylogeny, and expression profiling of representative genes in a dicot (Arabidopsis) and a monocot (rice) during reproduction and abiotic stress. DOI: 10.1104/pp.111.188300 ; PMID: 22021418
- γ-Aminobutyric acid transaminase deficiency impairs central carbon metabolism and leads to cell wall defects during salt stress in Arabidopsis roots. DOI: 10.1111/pce.12033 ; PMID: 23148892
- A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana. DOI: 10.1007/s10265-016-0900-6 ; PMID: 28004282
- SENSITIVE TO SALT1, An Endoplasmic Reticulum-Localized Chaperone, Positively Regulates Salt Resistance. DOI: 10.1104/pp.18.00840 ; PMID: 30287478
- Capturing the phosphorylation and protein interaction landscape of the plant TOR kinase. DOI: 10.1038/s41477-019-0378-z ; PMID: 30833711
- AtHsc70-1 negatively regulates the basal heat tolerance in Arabidopsis thaliana through affecting the activity of HsfAs and Hsp101. DOI: 10.1111/tpj.14883 ; PMID: 32573848
- The CBP/p300 histone acetyltransferases function as plant-specific MEDIATOR subunits in Arabidopsis. DOI: 10.1111/jipb.13052 ; PMID: 33325122
- Targeting conserved co-opted host factors to block virus replication: Using allosteric inhibitors of the cytosolic Hsp70s to interfere with tomato bushy stunt virus replication. DOI: 10.1016/j.virol.2021.08.002 ; PMID: 34399236
- Regulation of heat shock proteins 70 and their role in plant immunity. DOI: 10.1093/jxb/erab549 ; PMID: 35022724
- Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. DOI: 10.1104/pp.126.2.789 ; PMID: 11402207
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. DOI: 10.1105/tpc.107.051896 ; PMID: 18065690
Gene Resources
- UniProt: A0A178UTH3
- EMBL: CACRSJ010000110, CACSHJ010000096, LR881470
- AlphaFoldDB: A0A178UTH3
- EnsemblPlants: AT5G02490.1
- Gramene: AT5G02490.1
- KEGG: ath:AT5G02490
- Orthologous matrix: CWTSARR
- ExpressionAtlas: AT5G02490
- InterPro: IPR013126, IPR018181, IPR029047
- PANTHER: PTHR19375
- SUPFAM: SSF100920, SSF100934, SSF53067
- PROSITE: PS00297, PS00329, PS01036
- Gene3D: 1.20.1270.10, 2.60.34.10, 3.30.30.30
- OrthoDB: A0A178UTH3
- SWISS-MODEL: A0A178UTH3
- Conserved Domain Database: cd10233
Sequences
cDNA Sequence
- >AT5G02490.1
ATATCAGTTTTTTCCTCTTTTTTTCCAGGAACATATTTGCCTAGGATTTGGAAAAGGAATCTATCACTTAGCTACCGTCAGATCAACCTCAAACATAATCCAACGGTTATAAATAATTACAGAACATTCTGGAAACTCAAGTCTCAGCCTTATAAAAAACAAGACTTCAACGCTCTTTCTTCACAAACCTAAAAACCTAGCTCTATTCTTTCTCTTTGCTGCTCTTAAACTTTTTCTTAGCTTTTTCTATCTTCGTGTGATAATGGCTGGTAAAGGAGAAGGTCCTGCGATCGGTATCGATCTTGGTACGACGTACTCTTGCGTCGGAGTGTGGCAACACGACCGTGTTGAGATCATCGCTAATGATCAAGGAAACAGAACCACTCCCTCGTACGTTGCTTTCACTGACTCCGAGAGGTTGATCGGTGATGCTGCTAAGAACCAAGTCGCCATGAACCCTGTTAACACTGTTTTCGATGCAAAGAGGTTGATTGGTCGTAGATTCAGTGACGCATCTGTCCAAAGTGACAGACAGTTATGGCCTTTCACTATCATCTCCGGAACTGCAGAGAAACCAATGATTGTCGTCGAATACAAGGGAGAAGAGAAACAGTTCGCTGCTGAAGAGATCTCTTCCATGGTTCTTATTAAGATGCGTGAGATCGCTGAGGCTTTCCTTGGCACTACGGTCAAGAACGCTGTCGTCACTGTTCCTGCTTACTTCAATGACTCTCAACGTCAGGCTACAAAGGATGCTGGTGTCATCGCTGGTTTGAATGTTTTGCGTATCATCAACGAGCCCACTGCTGCAGCCATTGCTTATGGTCTTGACAAGAAGGCCACAAGTGTTGGAGAGAAGAATGTTTTGATCTTTGATCTTGGTGGTGGTACTTTTGATGTCTCTCTTCTTACAATCGAAGAGGGTATCTTTGAGGTGAAGGCAACAGCTGGTGATACTCATCTTGGTGGGGAAGATTTTGACAACAGAATGGTTAACCATTTTGTTCAAGAGTTTAAGAGAAAGAACAAGCAGGATATCACCGGTCAACCGAGAGCCCTCAGGAGATTGAGAACAGCTTGTGAGAGAGCAAAGAGGACTCTTTCTTCCACCGCTCAAACGACCATCGAGATTGACTCTTTATATGGTGGAGCTGACTTCTATTCTCCAATCACCCGTGCTAGATTCGAAGAGATGAACATGGATCTCTTTAGGAAGTGTATGGAGCCTGTTGAGAAGTGTCTCCGTGATGCTAAGATGGACAAGAGCACTGTTCACGAGATTGTCCTTGTTGGTGGATCCACCCGTATCCCTAAGGTTCAGCAATTGCTTCAGGACTTCTTCAACGGCAAAGAGCTTTGCAAGTCTATCAACCCTGATGAGGCTGTAGCTTATGGTGCAGCTGTTCAGGCTGCGATCCTAAGCGGTGAAGGAAACGAAAAGGTCCAAGACCTTCTCTTGCTTGATGTCACACCTCTCTCCCTTGGTCTTGAAACTGCTGGTGGTGTCATGACCACTTTGATTCAAAGAAACACAACCATTCCAACCAAGAAGGAACAGGTCTTCTCAACTTATTCGGACAACCAGCCTGGAGTGTTGATCCAAGTTTTTGAAGGTGAGAGGGCTAGGACCAAGGACAACAACCTCCTCGGTAAATTTGAGCTTTCTGGAATTCCCCCTGCTCCACGAGGTGTCCCTCAAATCACTGTCTGCTTCGACATTGACGCCAATGGTATCCTCAACGTCTCTGCTGAGGACAAGACCACTGGAAAGAAGAACAAGATCACAATCACTAATGACAAGGGTCGTTTGTCTAAAGAGGATATTGAGAAGATGGTTCAAGAAGCGGAGAAGTACAAGTCTGAGGATGAGGAGCACAAGAAGAAGGTCGAGGCCAAGAACGCTCTTGAGAACTACGCTTACAACATGAGGAACACCATCCGTGATGAGAAGATCGGTGAGAAGCTTCCAGCTGCAGACAAGAAGAAGGTTGAGGACTCTATTGAGGAAGCAATCCAATGGCTAGATGGTAACCAATTGGGTGAAGCTGACGAGTTTGAAGACAAGATGAAGGAGTTGGAGAGTGTTTGCAATCCGATCATCGCTAAGATGTACCAAGGAGGAGCTGGTGGTGAAGCTGGTGGTCCTGGAGCTTCTGGAATGGACGAGGATGAAGCTCCTCCTGCATCAGGTGGTGCTGGTCCCAAGATCGAGGAAGTCGACTAAGTGTTCTCTTAGTTATTTTGTCTTTTTATTTGAACTCTCTCAATTTAGTGTTGGATTTTATGTTCTACATTTTCTTTGATCTAAGTACTTTCTCTCTATTGTTTGGTCATTGGTGACCCCTTTCTCTTAACAATGCTTTAGTGGTCACTTGGTAGAAAGCTTTGTTATGAAAATTTCTTTACATGTCAGATTCACATAAGTGTGTTGAATATTTAACAAAGCTTCGAAGAAATGTGATCAAACTAGAAAAAAGTGAGAACG
CDS Sequence
Protein Sequence