Gene Details:
- Gene ID: AT5G02220
- Gene Symbol: SMR4
- Gene Name: SIAMESE-RELATED 4
- Description: cyclin-dependent kinase inhibitor;(source:Araport11)
- TAIR Accession: locus:2185213
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
Gene Ontology:
- GO:0051726 — acts upstream of or within — regulation of cell cycle
- GO:0098542 — acts upstream of or within — defense response to other organism
- GO:0140013 — acts upstream of or within — meiotic nuclear division
- GO:0005515 — enables — protein binding
- GO:0016070 — acts upstream of or within — RNA metabolic process
- GO:0032875 — involved in — regulation of DNA endoreduplication
- GO:0019219 — acts upstream of or within — regulation of nucleobase-containing compound metabolic process
- GO:0051301 — acts upstream of or within — cell division
- GO:0006810 — acts upstream of or within — transport
- GO:0008104 — acts upstream of or within — protein localization
- GO:0005634 — located in — nucleus
- GO:0005634 — is active in — nucleus
Function-related keywords:
Literature:
- ATR and ATM play both distinct and additive roles in response to ionizing radiation. DOI: 10.1111/j.1365-313X.2006.02931.x ; PMID: 17227549
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- Targeted interactomics reveals a complex core cell cycle machinery in Arabidopsis thaliana. DOI: 10.1038/msb.2010.53 ; PMID: 20706207
- The Arabidopsis SIAMESE-RELATED cyclin-dependent kinase inhibitors SMR5 and SMR7 regulate the DNA damage checkpoint in response to reactive oxygen species. DOI: 10.1105/tpc.113.118943 ; PMID: 24399300
- Suppressor of Gamma Response 1 Modulates the DNA Damage Response and Oxidative Stress Response in Leaves of Cadmium-Exposed Arabidopsis thaliana. DOI: 10.3389/fpls.2020.00366 ; PMID: 32308663
- A hierarchical transcriptional network activates specific CDK inhibitors that regulate G2 to control cell size and number in Arabidopsis. DOI: 10.1038/s41467-022-29316-2 ; PMID: 35351906
Sequences:
cDNA Sequence
- >AT5G02220.1
GATATATAAAATAAAGATGTAACCGCCTCTTCTCAGACTTCAAATTTTTTCCCTCTTACGACGATTTCGAGTTCGAGAGAGAAGAATGGAGGTGGTGGAGAGGAAGACGGAGATGGCGGAGGAAGGATGTACGACGCCGAGAAGCACGATGTATAGGATTCCGGTGGCGTCTGTTTGTCCACCGCCGCCGAGGAAGAAGTTGATGGTGGTGAGAAAACGAGATCCGCCGAGGAACGGGTACTTTCAGCCACCAGATCTTGAAACTTTGTTCTACGCACAGCCTCGAAGAGAAGCTTGCGCTTAGATTTTGAGATTTGATTTGATTTGAATTATCTAGGTTTTTTTTTTACTTTCTTCTCTGTAGATACATGTTTAGGGTTTGTTCTCTTATTAGATTTTATTTATCTTTCAGAGAGATGACTTTGTTTGTGTATCGAAATTGGAATTTGCTAAAATGAAACTTTGATCTGTTTTCCAATTCGAAATTTGTTGGCTTGTGTTCTAGATCTAATTAGTTCTTGTCGGAGATTGAAAGATTGATTGTTAAACTCTGATTATGCTGTTTATTGATTAGAGAGTTTTTTTCAACTACATAATTGGGTGAGAAAGTGAGGTTTAGAAACTGTGAACAAGACAACATCAAAAGCTTAACGAAAATTCAGATGAACCAATGTCTTTATTTGCTCTGTTTTTTTGGTTATTCATAAGTGTTGAAAAAGTAGTGCTCAAACTCTTT
CDS Sequence
Protein Sequence