Gene Details:
- Gene ID: AT4G32410
- Gene Symbol: ANY1, AtCESA1, CESA1, RSW1
- Gene Name: anisotropy1, CELLULOSE SYNTHASE 1, cellulose synthase 1, RADIALLY SWOLLEN 1
- Description: cellulose synthase 1;(source:Araport11)
- TAIR Accession: locus:2127776
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0009832 — acts upstream of or within — plant-type cell wall biogenesis
- GO:0005886 — located in — plasma membrane
- GO:0030244 — acts upstream of or within — cellulose biosynthetic process
- GO:0005794 — located in — Golgi apparatus
- GO:0009825 — acts upstream of or within — multidimensional cell growth
- GO:0009833 — acts upstream of or within — plant-type primary cell wall biogenesis
- GO:0016759 — enables — cellulose synthase activity
- GO:0030244 — involved in — cellulose biosynthetic process
- GO:0005802 — located in — trans-Golgi network
- GO:0005515 — enables — protein binding
- GO:0042538 — acts upstream of or within — hyperosmotic salinity response
- GO:0005768 — located in — endosome
- GO:0016757 — enables — glycosyltransferase activity
- GO:0016760 — enables — cellulose synthase (UDP-forming) activity
- GO:0009833 — involved in — plant-type primary cell wall biogenesis
- GO:0005886 — is active in — plasma membrane
Germplasm Phenotype:
- CS6124 — strong allele, embryo defective, lethal; embryos are radially swollen with strongly reduced cellulose content, especially at the late bent cotyledon stage of embryogenesis; embryos have altered cell elongation and thin epidermal cell walls which are deficient in crystalline cellulose
- CS6554 — Reduced cellulose content in roots; radial swelling of root tips in plants grown at the restrictive temperature of 31C, occurring primarily in the epidermal and cortical layers of the root.
- SAIL_1303_D08 — Gametophytic lethal. 50% pollen grains from the heterozygous plants are significantly deformed, without pollen tube formation.
- SAIL_278_E08 — Gametophytic lethal. 50% pollen grains from the heterozygous plants are significantly deformed, without pollen tube formation.
- rsw1-10 — Showed comparable decreases in the length of dark-grown hypocotyls, accompanied by increases in width in both epidermal and cortical cells. FTIR microspectroscopy also indicated a cellulose deficiency in epidermal or cortical cells.
- rsw1-10 — The greenhouse-grown mutant was slightly dwarfed.
- rsw1-10 prc1-18 — Both mutation are additive, as shown by the further shortened hypocotyl length of the double mutant.
- the1-3 rsw1-10 — Partial reversion of the hypocotyl-elongation defect of rsw1-10.
Function-related keywords:
- shoot axis apex , leaf lamina base , shoot system , plant embryo , vascular leaf , stamen , sepal , flower , inflorescence flower pedicel , cotyledon , petiole , hypocotyl , leaf apex , collective leaf structure , pollen , guard cell
Literature:
- A comparative analysis of the plant cellulose synthase (CesA) gene family. DOI: 10.1104/pp.123.4.1313 ; PMID: 10938350
- Mapping the Arabidopsis organelle proteome. DOI: 10.1073/pnas.0506958103 ; PMID: 16618929
- Interactions between MUR10/CesA7-dependent secondary cellulose biosynthesis and primary cell wall structure. DOI: 10.1104/pp.106.087700 ; PMID: 17041031
- Genetic evidence for three unique components in primary cell-wall cellulose synthase complexes in Arabidopsis. DOI: 10.1073/pnas.0706592104 ; PMID: 17878302
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Thaxtomin A affects CESA-complex density, expression of cell wall genes, cell wall composition, and causes ectopic lignification in Arabidopsis thaliana seedlings. DOI: 10.1093/jxb/ern344 ; PMID: 19269997
- The GLABRA2 homeodomain protein directly regulates CESA5 and XTH17 gene expression in Arabidopsis roots. DOI: 10.1111/j.1365-313X.2009.03976.x ; PMID: 19619157
- Phylogenetically distinct cellulose synthase genes support secondary wall thickening in arabidopsis shoot trichomes and cotton fiber. DOI: 10.1111/j.1744-7909.2010.00934.x ; PMID: 20377682
- Brassinosteroids can regulate cellulose biosynthesis by controlling the expression of CESA genes in Arabidopsis. DOI: 10.1093/jxb/err164 ; PMID: 21617247
- Phytochrome regulation of cellulose synthesis in Arabidopsis. DOI: 10.1016/j.cub.2011.09.026 ; PMID: 22036185
- γ-Aminobutyric acid transaminase deficiency impairs central carbon metabolism and leads to cell wall defects during salt stress in Arabidopsis roots. DOI: 10.1111/pce.12033 ; PMID: 23148892
- Functional analysis of complexes with mixed primary and secondary cellulose synthases. DOI: 10.4161/psb.23179 ; PMID: 23299322
- Label-free protein quantification for plant Golgi protein localization and abundance. DOI: 10.1104/pp.114.245589 ; PMID: 25122472
- A Mechanism for Sustained Cellulose Synthesis during Salt Stress. DOI: 10.1016/j.cell.2015.08.028 ; PMID: 26343580
- Mitochondrial Defects Confer Tolerance against Cellulose Deficiency. DOI: 10.1105/tpc.16.00540 ; PMID: 27543091
- Dissecting the contribution of microtubule behaviour in adventitious root induction. DOI: 10.1093/jxb/erv097 ; PMID: 25788735
- Cellulose Synthase Mutants Distinctively Affect Cell Growth and Cell Wall Integrity for Plant Biomass Production in Arabidopsis. DOI: 10.1093/pcp/pcy050 ; PMID: 29514326
- Arabidopsis Group IIId ERF proteins positively regulate primary cell wall-type CESA genes. DOI: 10.1007/s10265-018-1074-1 ; PMID: 30478480
- The Photoperiodic Flowering Time Regulator FKF1 Negatively Regulates Cellulose Biosynthesis. DOI: 10.1104/pp.19.00013 ; PMID: 31221729
- Genome-wide identification of EMBRYO-DEFECTIVE (EMB) genes required for growth and development in Arabidopsis. DOI: 10.1111/nph.16071 ; PMID: 31334862
- Seed-specific down-regulation of Arabidopsis CELLULOSE SYNTHASE 1 or 9 reduces seed cellulose content and differentially affects carbon partitioning. DOI: 10.1007/s00299-020-02541-z ; PMID: 32314045
- Spaceflight induces novel regulatory responses in Arabidopsis seedling as revealed by combined proteomic and transcriptomic analyses. DOI: 10.1186/s12870-020-02392-6 ; PMID: 32460700
- Inhibition of cell expansion enhances cortical microtubule stability in the root apex of Arabidopsis thaliana. DOI: 10.1186/s40709-021-00143-8 ; PMID: 34082808
- Peripheral membrane proteins modulate stress tolerance by safeguarding cellulose synthases. DOI: 10.1126/sciadv.abq6971 ; PMID: 36383676
- Nitric oxide induces S-nitrosylation of CESA1 and CESA9 and increases cellulose content in Arabidopsis hypocotyls. DOI: 10.1016/j.plaphy.2023.01.032 ; PMID: 36680948
- A comparative analysis of the plant cellulose synthase (CesA) gene family. DOI: 10.1104/pp.123.4.1313 ; PMID: 10938350
- The irregular xylem3 locus of Arabidopsis encodes a cellulose synthase required for secondary cell wall synthesis. DOI: 10.1105/tpc.11.5.769 ; PMID: 10330464
- Molecular analysis of cellulose biosynthesis in Arabidopsis. DOI: 10.1126/science.279.5351.717 ; PMID: 9445479
- Alpha-glucosidase I is required for cellulose biosynthesis and morphogenesis in Arabidopsis. DOI: 10.1083/jcb.200111093 ; PMID: 11901167
- Mutation or drug-dependent microtubule disruption causes radial swelling without altering parallel cellulose microfibril deposition in Arabidopsis root cells. DOI: 10.1105/tpc.011593 ; PMID: 12782733
- Large-scale analysis of in vivo phosphorylated membrane proteins by immobilized metal ion affinity chromatography and mass spectrometry. DOI: 10.1074/mcp.T300006-MCP200 ; PMID: 14506206
- Mapping the Arabidopsis organelle proteome. DOI: 10.1073/pnas.0506958103 ; PMID: 16618929
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. DOI: 10.1105/tpc.106.048058 ; PMID: 17351116
- A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis. DOI: 10.1016/j.cub.2007.05.018 ; PMID: 17540573
- Genetic evidence for three unique components in primary cell-wall cellulose synthase complexes in Arabidopsis. DOI: 10.1073/pnas.0706592104 ; PMID: 17878302
- Features of the primary wall CESA complex in wild type and cellulose-deficient mutants of Arabidopsis thaliana. DOI: 10.1093/jxb/ern125 ; PMID: 18495638
Sequences:
cDNA Sequence
- >AT4G32410.1
TTTTAATATAATCAAACAATCATACTTTGTCCTATCTCTTTCTTGCAATAAGATTTTGCCACGTCACATACTAAGAAGCTGGCGCGTCTAGTGGGGAAGCCAGAACGGCTCACTTTAAAAAGTAGAGAGATGATAACTTGAGCCGAATAGAGCCGAGCTGAGCTAAAACGGTGGGAGAGGAAGAGGCTACTACTACCGTCACCATCTCCGGTAAAATAATGTACTTGTCATTTAAAAATTAAGAAAAAACACATCACTCTGCGATAAAATAGGCAAAAGCAGATTTGAAGAAGAAGCAGCTTGAGATATCAAATAGAGAGAGAGAGTGACAGAGGAGTGTGTGAACATCCTTTTTTAGTAGATTTGGGTTTTCGAGATGCCGTATTGAATCGGCTACGAATTTCCCAATTTTGAATTTTGTGAATCTCTCTCTTTCTCTGTGTGTCGGTGGCTGCGATGGAGGCCAGTGCCGGCTTGGTTGCTGGATCCTACCGGAGAAACGAGCTCGTTCGGATCCGACATGAATCTGATGGCGGGACCAAACCTTTGAAGAATATGAATGGCCAGATATGTCAGATCTGTGGTGATGATGTTGGACTCGCTGAAACTGGAGATGTCTTTGTCGCGTGTAATGAATGTGCCTTCCCTGTGTGTCGGCCTTGCTATGAGTACGAGAGGAAAGATGGAACTCAGTGTTGCCCTCAATGCAAGACTAGATTCAGACGACACAGGGGGAGTCCTCGTGTTGAAGGAGATGAAGATGAGGATGATGTTGATGATATCGAGAATGAGTTCAATTACGCCCAGGGAGCTAACAAGGCGAGACACCAACGCCATGGCGAAGAGTTTTCTTCTTCCTCTAGACATGAATCTCAACCAATTCCTCTTCTCACCCATGGCCATACGGTTTCTGGAGAGATTCGCACGCCTGATACACAATCTGTGCGAACTACATCAGGTCCTTTGGGTCCTTCTGACAGGAATGCTATTTCATCTCCATATATTGATCCACGGCAACCTGTCCCTGTAAGAATCGTGGACCCGTCAAAAGACTTGAACTCTTATGGGCTTGGTAATGTTGACTGGAAAGAAAGAGTTGAAGGCTGGAAGCTGAAGCAGGAGAAAAATATGTTACAGATGACTGGTAAATACCATGAAGGGAAAGGAGGAGAAATTGAAGGGACTGGTTCCAATGGCGAAGAACTCCAAATGGCTGATGATACACGTCTTCCTATGAGTCGTGTGGTGCCTATCCCATCTTCTCGCCTAACCCCTTATCGGGTTGTGATTATTCTCCGGCTTATCATCTTGTGTTTCTTCTTGCAATATCGTACAACTCACCCTGTGAAAAATGCATATCCTTTGTGGTTGACCTCGGTTATCTGTGAGATCTGGTTTGCATTTTCTTGGCTTCTTGATCAGTTTCCCAAATGGTACCCCATTAACAGGGAGACTTATCTTGACCGTCTCGCTATAAGATATGATCGAGACGGTGAACCATCACAGCTCGTTCCTGTTGATGTGTTTGTTAGTACAGTGGACCCATTGAAAGAGCCTCCCCTTGTTACAGCAAACACAGTTCTCTCGATTCTTTCTGTGGACTACCCGGTAGATAAAGTAGCCTGTTATGTTTCAGATGATGGTTCAGCTATGCTTACCTTTGAATCCCTTTCTGAAACCGCTGAGTTTGCAAAGAAATGGGTACCATTTTGCAAGAAATTCAACATTGAACCTAGGGCCCCTGAATTCTATTTTGCCCAGAAGATAGATTACTTGAAGGACAAGATCCAACCGTCTTTTGTTAAAGAGCGACGAGCTATGAAGAGAGAGTATGAAGAGTTTAAAGTGAGGATAAATGCTCTTGTTGCCAAAGCACAGAAAATCCCTGAAGAAGGCTGGACAATGCAGGATGGTACTCCCTGGCCTGGTAACAACACTAGAGATCATCCTGGAATGATACAGGTGTTCTTAGGCCATAGTGGGGGTCTGGATACCGATGGAAATGAGCTGCCTAGACTCATCTATGTTTCTCGTGAAAAGCGGCCTGGATTTCAACACCACAAAAAGGCTGGAGCTATGAATGCATTGATCCGTGTATCTGCTGTTCTTACCAATGGAGCATATCTTTTGAACGTGGATTGTGATCATTACTTTAATAACAGTAAGGCTATTAAAGAAGCTATGTGTTTCATGATGGACCCGGCTATTGGAAAGAAGTGCTGCTATGTCCAGTTCCCTCAACGTTTTGACGGTATTGATTTGCACGATCGATATGCCAACAGGAATATAGTCTTTTTCGATATTAACATGAAGGGGTTGGATGGTATCCAGGGTCCAGTATATGTGGGTACTGGTTGTTGTTTTAATAGGCAGGCTCTATATGGGTATGATCCTGTTTTGACGGAAGAAGATTTAGAACCAAATATTATTGTCAAGAGCTGTTGCGGGTCAAGGAAGAAAGGTAAAAGTAGCAAGAAGTATAACTACGAAAAGAGGAGAGGCATCAACAGAAGTGACTCCAATGCTCCACTTTTCAATATGGAGGACATCGATGAGGGTTTTGAAGGTTATGATGATGAGAGGTCTATTCTAATGTCCCAGAGGAGTGTAGAGAAGCGTTTTGGTCAGTCGCCGGTATTTATTGCGGCAACCTTCATGGAACAAGGCGGCATTCCACCAACAACCAATCCCGCTACTCTTCTGAAGGAGGCTATTCATGTTATAAGCTGTGGTTACGAAGACAAGACTGAATGGGGCAAAGAGATTGGTTGGATCTATGGTTCCGTGACGGAAGATATTCTTACTGGGTTCAAGATGCATGCCCGGGGTTGGATATCGATCTACTGCAATCCTCCACGCCCTGCGTTCAAGGGATCTGCACCAATCAATCTTTCTGATCGTTTGAACCAAGTTCTTCGATGGGCTTTGGGATCTATCGAGATTCTTCTTAGCAGACATTGTCCTATCTGGTATGGTTACCATGGAAGGTTGAGACTTTTGGAGAGGATCGCTTATATCAACACCATCGTCTATCCTATTACATCCATCCCTCTTATTGCGTATTGTATTCTTCCCGCTTTTTGTCTCATCACCGACAGATTCATCATACCCGAGATAAGCAACTACGCGAGTATTTGGTTCATTCTACTCTTCATCTCAATTGCTGTGACTGGAATCCTGGAGCTGAGATGGAGCGGTGTGAGCATTGAGGATTGGTGGAGGAACGAGCAGTTCTGGGTCATTGGTGGCACATCCGCCCATCTTTTTGCTGTCTTCCAAGGTCTACTTAAGGTTCTTGCTGGTATCGACACCAACTTCACCGTTACATCTAAAGCCACAGACGAAGATGGGGATTTTGCAGAACTCTACATCTTCAAATGGACAGCTCTTCTCATTCCACCAACCACCGTCCTACTTGTGAACCTCATAGGCATTGTGGCTGGTGTCTCTTATGCTGTAAACAGTGGCTACCAGTCGTGGGGTCCGCTTTTCGGGAAGCTCTTCTTCGCCTTATGGGTTATTGCCCATCTCTACCCTTTCTTGAAAGGTCTGTTGGGAAGACAAAACCGAACACCAACCATCGTCATTGTCTGGTCTGTTCTTCTCGCCTCCATCTTCTCGTTGCTTTGGGTCAGGATCAATCCCTTTGTGGACGCCAATCCCAATGCCAACAACTTCAATGGCAAAGGAGGTGTCTTTTAGACCCTATTTATATACTTGTGTGTGCATATATCAAAAACGCGCAATGGGAATTCCAAATCATCTAAACCCATCAAACCCCAGTGAACCGGGCAGTTAAGGTGATTCCATGTCCAAGATTAGCTTTCTCCGAGTAGCCAGAGAAGGTGAAATTGTTCGTAACACTATTGTAATGATTTTCCAGTGGGGAAGAAGATGTGGACCCAAATGATACATAGTCTACAAAAAGAATTTGTTATTCTTTCTTATATTTATTTTATTTAAAGCTTGTTAGACTCACACTTATGTAATGTTGGAACTTGTTGTCCTAAAAAGGGATTGGAGTTTTCTTTTTATCTAAGAATCTGAAGTTTATATGCTAAGCTTTTCACTTTACTACAAAAAGTTTATGGATATGATGGTGTACGTCAATTGTTGGTGCAAGTGTTGATGTCTTCGGGTGAACTCGCCCTCTTGTTTTGTCTCACCCATCAGTACAAATAGAATGACATTTATTTTTTTGAACTTTTAACGAAATCTTTG
CDS Sequence
Protein Sequence