Information report for AT4G30870
Gene Details
|
|
Functional Descriptions
- GO:0048476 — part of — Holliday junction resolvase complex
- GO:0006281 — involved in — DNA repair
- GO:0000727 — involved in — double-strand break repair via break-induced replication
- GO:0007129 — acts upstream of or within — homologous chromosome pairing at meiosis
- GO:0006308 — involved in — DNA catabolic process
- GO:0000724 — acts upstream of or within — double-strand break repair via homologous recombination
- GO:0000712 — involved in — resolution of meiotic recombination intermediates
- GO:0005634 — is active in — nucleus
- GO:0051026 — acts upstream of or within — chiasma assembly
- GO:0031573 — involved in — mitotic intra-S DNA damage checkpoint signaling
- GO:0006974 — involved in — DNA damage response
- GO:0000794 — located in — condensed nuclear chromosome
- GO:0000723 — involved in — telomere maintenance
- GO:0008821 — contributes to — crossover junction DNA endonuclease activity
- GO:0006281 — acts upstream of or within — DNA repair
- GO:0048257 — enables — 3-flap endonuclease activity GO:0048257 17230 F catalytic activity IBA none PANTHER:PTN000335543|UniProtKB:Q96NY9 Communication:501741973 2021-04-02 AT4G30870 locus:2126729 AT4G30870 involved in DNA repair GO:0006281 4741 P response to stress IMP none Publication:501767564|PMID:26704385 2021-03-31 AT4G30870 locus:2126729 AT4G30870 involved in resolution of meiotic recombination intermediates GO:0000712 11804 P cell cycle IBA none PANTHER:PTN000335543|SGD:S000002794|WB:WBGene00016602|PomBase:SPCC4G3.05c Communication:501741973 2023-06-07 AT4G30870 locus:2126729 AT4G30870 acts upstream of or within chiasma assembly GO:0051026 18777 P reproduction IGI double mutant analysis Tair:gene:2130912 Publication:501723987|PMID:18182028 TAIR 2008-07-08 AT4G30870 locus:2126729 AT4G30870 involved in mitotic intra-S DNA damage checkpoint signaling GO:0031573 21660 P other cellular processes IBA none PANTHER:PTN000335543|PomBase:SPCC4G3.05c Communication:501741973 2021-03-31 AT4G30870 locus:2126729 AT4G30870 acts upstream of or within chiasma assembly GO:0051026 18777 P cellular component organization IGI double mutant analysis Tair:gene:2130912 Publication:501723987|PMID:18182028 TAIR 2008-07-08 AT4G30870 locus:2126729 AT4G30870 involved in resolution of meiotic recombination intermediates GO:0000712 11804 P cellular component organization IBA none PANTHER:PTN000335543|SGD:S000002794|WB:WBGene00016602|PomBase:SPCC4G3.05c Communication:501741973 2023-06-07 AT4G30870 locus:2126729 AT4G30870 acts upstream of or within homologous chromosome pairing at meiosis GO:0007129 7366 P cell cycle IGI double mutant analysis AGI_LocusCode:AT4G14970 Publication:501778430|PMID:29352063 TAIR 2018-03-22 AT4G30870 locus:2126729 AT4G30870 involved in DNA damage response GO:0006974 4725 P response to stress IEP none Publication:501729770|PMID:17696612 2021-03-31 AT4G30870 locus:2126729 AT4G30870 acts upstream of or within DNA repair GO:0006281 4741 P other cellular processes IMP analysis of physiological response NONE Publication:501720007|PMID:16945961 TAIR 2006-11-13 AT4G30870 locus:2126729 AT4G30870 involved in resolution of meiotic recombination intermediates GO:0000712 11804 P other cellular processes IBA none PANTHER:PTN000335543|SGD:S000002794|WB:WBGene00016602|PomBase:SPCC4G3.05c Communication:501741973 2023-06-07 AT4G30870 locus:2126729 AT4G30870 acts upstream of or within chiasma assembly GO:0051026 18777 P other cellular processes IGI double mutant analysis Tair:gene:2130912 Publication:501723987|PMID:18182028 TAIR 2008-07-08 AT4G30870 locus:2126729 AT4G30870 enables endonuclease activity GO:0004519 2238 F nuclease activity ISS Sequence similarity (homologue of/most closely related to) SGD:MUS81 Publication:501720007|PMID:16945961 TAIR 2006-12-18 AT4G30870 gene:3439322 AT4G30870.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT4G30870 locus:2126729 AT4G30870 involved in double-strand break repair via break-induced replication GO:0000727 13296 P response to stress IBA none PANTHER:PTN000335543|SGD:S000002794 Communication:501741973 2021-03-31 AT4G30870 locus:2126729 AT4G30870 acts upstream of or within homologous chromosome pairing at meiosis GO:0007129 7366 P other cellular processes IGI double mutant analysis AGI_LocusCode:AT4G14970 Publication:501778430|PMID:29352063 TAIR 2018-03-22 AT4G30870 locus:2126729 AT4G30870 acts upstream of or within homologous chromosome pairing at meiosis GO:0007129 7366 P cellular component organization IGI double mutant analysis AGI_LocusCode:AT4G14970 Publication:501778430|PMID:29352063 TAIR 2018-03-22 AT4G30870 locus:2126729 AT4G30870 involved in DNA catabolic process GO:0006308 4730 P catabolic process IEA none InterPro:IPR033309 AnalysisReference:501756966 2023-06-11 AT4G30870 locus:2126729 AT4G30870 involved in resolution of meiotic recombination intermediates GO:0000712 11804 P reproduction IBA none PANTHER:PTN000335543|SGD:S000002794|WB:WBGene00016602|PomBase:SPCC4G3.05c Communication:501741973 2023-06-07 AT4G30870 locus:2126729 AT4G30870 acts upstream of or within mitotic recombination GO:0006312 6401 P DNA metabolic process IMP none NONE Publication:501720007|PMID:16945961 TAIR 2006-11-13 AT4G30870 locus:2126729 AT4G30870 involved in DNA catabolic process GO:0006308 4730 P other cellular processes IEA none InterPro:IPR033309 AnalysisReference:501756966 2023-06-11 AT4G30870 locus:2126729 AT4G30870 contributes to crossover junction DNA endonuclease activity GO:0008821 2009 F nuclease activity IBA none PANTHER:PTN000335543|SGD:S000002794 Communication:501741973 2022-11-23 AT4G30870 locus:2126729 AT4G30870 acts upstream of or within double-strand break repair via homologous recombination GO:0000724 14226 P other cellular processes IMP biochemical/chemical analysis NONE Publication:501740121|PMID:20971895 TAIR 2010-12-21 AT4G30870 locus:2126729 AT4G30870 enables 3-flap endonuclease activity
- GABI_113F11 — Deficiency in homologous recombination in somatic cells but only after induction by genotoxic stress.
- SALK_107515 — Deficiency in homologous recombination in somatic cells but only after induction by genotoxic stress.
- fancd2-1 mus81-2 — increased percentage of cells with univalents as compared to single mutant mus81-2, also observed cells with more than one chromosome pair affected in the double mutant.
- hrq1-1 mus81-1 — Significant reduction of FW after treatment with cisplatin and MMC.
- msh4 mus81-2 fancd2-1 — Fewer bivalents then the msh4 mus81-2 double mutant; 67.6% of the msh4 mus81-2 fancd2-1 triple mutant meiocytes contain no bivalents (2.4% in the double mutant); 26.5% of the cells display one, and only 5.9% have two bivalents (compared to 31.7% and 46.3%, respectively, in the msh4 mus81-2 double mutants).
- mus81-1 — Severe reduction in relative FW when exposed to crosslinkers cisplatin and MMC.
Functional Keywords
Literature and News
- Functional hammerhead ribozymes naturally encoded in the genome of Arabidopsis thaliana. DOI: 10.1105/tpc.105.032730 ; PMID: 15937227
- The role of AtMUS81 in DNA repair and its genetic interaction with the helicase AtRecQ4A. DOI: 10.1093/nar/gkl576 ; PMID: 16945961
- The road to crossovers: plants have their say. DOI: 10.1016/j.tig.2006.12.007 ; PMID: 17208327
- Two distinct MUS81-EME1 complexes from Arabidopsis process Holliday junctions. DOI: 10.1104/pp.109.136846 ; PMID: 19339504
- RAD5A, RECQ4A, and MUS81 have specific functions in homologous recombination and define different pathways of DNA repair in Arabidopsis thaliana. DOI: 10.1105/tpc.110.078568 ; PMID: 20971895
- Systematic identification of functional plant modules through the integration of complementary data sources. DOI: 10.1104/pp.112.196725 ; PMID: 22589469
- MHF1 plays Fanconi anaemia complementation group M protein (FANCM)-dependent and FANCM-independent roles in DNA repair and homologous recombination in plants. DOI: 10.1111/tpj.12507 ; PMID: 24635147
- The Arabidopsis thaliana homolog of the helicase RTEL1 plays multiple roles in preserving genome stability. DOI: 10.1105/tpc.114.132472 ; PMID: 25516598
- The nuclease FAN1 is involved in DNA crosslink repair in Arabidopsis thaliana independently of the nuclease MUS81. DOI: 10.1093/nar/gkv208 ; PMID: 25779053
- Formation of interference-sensitive meiotic cross-overs requires sufficient DNA leading-strand elongation. DOI: 10.1073/pnas.1507165112 ; PMID: 26392549
- The Translesion Polymerase ζ Has Roles Dependent on and Independent of the Nuclease MUS81 and the Helicase RECQ4A in DNA Damage Repair in Arabidopsis. DOI: 10.1104/pp.15.00806 ; PMID: 26474640
- The Structure-Specific Endonucleases MUS81 and SEND1 Are Essential for Telomere Stability in Arabidopsis. DOI: 10.1105/tpc.15.00898 ; PMID: 26704385
- Analysis of the Relationships between DNA Double-Strand Breaks, Synaptonemal Complex and Crossovers Using the Atfas1-4 Mutant. DOI: 10.1371/journal.pgen.1005301 ; PMID: 26147458
- The DNA translocase RAD5A acts independently of the other main DNA repair pathways, and requires both its ATPase and RING domain for activity in Arabidopsis thaliana. DOI: 10.1111/tpj.13602 ; PMID: 28509359
- Arabidopsis thaliana FANCD2 Promotes Meiotic Crossover Formation. DOI: 10.1105/tpc.17.00745 ; PMID: 29352063
- The RecQ-like helicase HRQ1 is involved in DNA crosslink repair in Arabidopsis in a common pathway with the Fanconi anemia-associated nuclease FAN1 and the postreplicative repair ATPase RAD5A. DOI: 10.1111/nph.15109 ; PMID: 29577315
- The topoisomerase 3α zinc-finger domain T1 of Arabidopsis thaliana is required for targeting the enzyme activity to Holliday junction-like DNA repair intermediates. DOI: 10.1371/journal.pgen.1007674 ; PMID: 30222730
- The Protease WSS1A, the Endonuclease MUS81, and the Phosphodiesterase TDP1 Are Involved in Independent Pathways of DNA-protein Crosslink Repair in Plants. DOI: 10.1105/tpc.18.00824 ; PMID: 30760561
- An Arabidopsis FANCJ helicase homologue is required for DNA crosslink repair and rDNA repeat stability. DOI: 10.1371/journal.pgen.1008174 ; PMID: 31120885
- ATM controls meiotic DNA double-strand break formation and recombination and affects synaptonemal complex organization in plants. DOI: 10.1093/plcell/koab045 ; PMID: 33659989
- Comparative transcriptomic analysis of thermally stressed Arabidopsis thaliana meiotic recombination mutants. DOI: 10.1186/s12864-021-07497-2 ; PMID: 33711924
- The repair of topoisomerase 2 cleavage complexes in Arabidopsis. DOI: 10.1093/plcell/koab228 ; PMID: 34524446
- Regulation of interference-sensitive crossover distribution ensures crossover assurance in Arabidopsis. DOI: 10.1073/pnas.2107543118 ; PMID: 34795056
- The FANCC-FANCE-FANCF complex is evolutionarily conserved and regulates meiotic recombination. DOI: 10.1093/nar/gkac1244 ; PMID: 36652992
- SMC5/6 complex-mediated SUMOylation stimulates DNA-protein cross-link repair in Arabidopsis. DOI: 10.1093/plcell/koad020 ; PMID: 36705512
- The Arabidopsis Hop1 homolog ASY1 mediates cross-over assurance and interference. DOI: 10.1093/pnasnexus/pgac302 ; PMID: 36992817
- Two distinct MUS81-EME1 complexes from Arabidopsis process Holliday junctions. DOI: 10.1104/pp.109.136846 ; PMID: 19339504
Gene Resources
Sequences
cDNA Sequence
- >AT4G30870.1
CAAGAGAAGGTTTTAGTCAAAATCCCCATTTTTTAAAAATTCTCAACAAAACGCCTAAAAACTGAAAGTGCTTATTCCTCTTCTCCGGCGAACCAAAGATCAAACCTTTGCGAGAGAATTTCCCTCTTTTTCGGCAACGAGTATATCCAATCAGCAAGGAATTTTATGATCGCTTGATAAATTGAAACTATTTGGAGTGGGTAGTGATGGATGACGAGAGACGGGTACTGTGCCCTGAGAACCGAGGTTTAGCGGCTTATGTGTTGCAGAAGAAGCAAGAATACGCAGAAAAGCCCAAAGGCTTGTCGGAAAATCTGGAGAGGACATTTGTTAAGGGGTATAGGAGTGTCTGCGACGCCAAGGATCCCATTAACACACTCAAAGACTTGTCGCAGATCAAGGGCTTTGGCAAGTGGATGGTTAAGCTCATGAAAGGATATTTTGATACTGCTGTTGAAAGTTCTGAGCAAGAAGATTTACCTGATAATCGTGCTGGGAAAAAGGCCAATGGAAAAAAACGGTACATTCCGCAAAGAAATTCAGTGGGATATGCATTACTAATAACGTTGCACAGAAGGACTACAAATGGGAAAGAATTCATGCGTAAACAAGAGCTTATTGATGCTGCTGACGCGAATGGGCTATCACACGCTCCTGTTGGGCCAGAGAAAGGGAAAGGGAAAGCAGGACTTGGACACTCTAAGAGGGAGTGGTATAGTGGATGGAGCTGCATGACCACTCTTATACAGAAGGGATTAGTGGTGAAATCTAGCAACCCAGCAAAGTACATGCTGACAGTTGAAGGTCGGGAAGTTGCAAATGAGTGTATCCTGCGATCTGGATTACCTGATTCAGTTGATATCTTATCTGTTGATGAAATGGATCCTACACCGCAAGCAAAGAAAACACCTAATCAAAATCCCACCTGTTCGTTTACCATGAGAGAAGAACTTCCATATGTCGATCCAAGATGTAGGGCACAATCAGCCATTCCAAGCGATATTCTTGAAAAGTTTACTCCGTTTGGTTATTCGAAGGAACAAGTCGTTGCTGCATTCAGAGAGGTTTCAGATGGATCTGGGGACAAAGATCCATCAACTCTCTGGCTCTCTGTAATGTGCCATCTTCGTCAAGCAGAGGTTTATAATTCCTGTCCGGACTCGAGAAATAGTAAAAAGGATTCATCAGGACCTTTTAAATCACAAATTCGTCAAGTTGATCTTGAGGGATCTCGTGCTAAGAAGTTCCGCTCTTGCAATGATGGATCCACCTTAAATCCATGTTCATCAGGTTCAAGTCATGCTGTGAAAGCCTGCTCATCTTCTTTGGCATCAGATGGAACCAAAGGAATAACAAATATTCCACGCCTCCCTCCTCTTCAATTTGGAGAAACGTTTGAGGAAGCATATGATGTGATCTTGATACTGGATGATCGAGAAAAGTTTGCCACCAAAGGATCACGATCCAGGAATATAGTTGAAAACATATGCTCTGAATTCAACATCAAGATTGAGGTTAGACGATTACCAGTCGGGGATTGTATATGGATTGCTCGGCATAAGTACCTTGAGACTGAATATGTTCTAGACTTTATTGCTGAGAGGAAGAACGTTGATGATATGCGCTCATCAATTAGAGATAATCGCTACAGAGACCAAAAACTTAGACTTCAGAGATCGGGATTCAAGAAGCTCATATACATTCTTGAAGGGGATCCAAACCATTCTGATGCAGCAGAAAGCATTAAAACAGCTTGTTTCACGACAGAGATTCTGGAGGGATTTGATGTGCTGAGGACACACGGGCTGGGTGAGACGCTAAGAAAATACGGCTACCTCACGAAATCAATATATCAATACTACAAGTTACGGGTGAATGATAATGACCAGAGCAAAGGCGCAGCCTCATGTCCTTCTTTTGATAGTTTTGTCAAAAGGTGTCAAGACCTTGATAAAATGACAATCAGCGATGTATTTGCCATTCAGCTAATGCAGGTCCCGCAGGTAACGGAGGAAATTGCCATAGCGGTTCTTGATATGTACCCAACGCTTTTGTCTCTTGCTTCTGCCTATTCTCATCTAGAAGCAGATGTCTCGGCGCAAGAAGAGATGTTGAGAAATAGAAGCAACAATGTAATATGTGCATCAGCTAGTAAGAATATATTCAAGTTAGTTTGGGGTGAATGACTTCTATTCTAGTGTGTGTCCCTTTGACCTTTGTCTAGAGAGAGAGAGAGAGATCTGAAACTGATGAAGTGCATATGTATAATAAGCCATGTGTTGTTTTTTTAGATTTTCTGCTTGTAACTGAAGCTTAGGCTCGCCAATTGTATAACTTCAATGTTTCAATGTTTTGTTTTACGTTACTTCA
CDS Sequence
Protein Sequence