Information report for AT4G29340
Gene Details
|
|
Functional Descriptions
- PO:0020047 — microsporocyte — microsporocito (Spanish, exact), 小胞子母細胞 (Japanese, exact), PMC (related), microspore mother cell (related), pollen mother cell (related), Poaceae microsporocyte (narrow), Zea microsporocyte (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- GO:0042989 — involved in — sequestering of actin monomers
- GO:0005737 — located in — cytoplasm
- GO:0005938 — is active in — cell cortex
- GO:0003785 — enables — actin monomer binding
- GO:0005634 — located in — nucleus
Functional Keywords
Literature and News
- The Arabidopsis profilin gene family. Evidence for an ancient split between constitutive and pollen-specific profilin genes. DOI: 10.1104/pp.111.1.115 ; PMID: 8685262
- Comparative analysis of the Arabidopsis pollen transcriptome. DOI: 10.1104/pp.103.020925 ; PMID: 12805594
- Transcriptional profiling of Arabidopsis tissues reveals the unique characteristics of the pollen transcriptome. DOI: 10.1104/pp.103.028241 ; PMID: 14500793
- Cesium toxicity in Arabidopsis. DOI: 10.1104/pp.104.046672 ; PMID: 15489280
- Molecular dissection of plant cytokinesis and phragmoplast structure: a survey of GFP-tagged proteins. DOI: 10.1111/j.1365-313X.2004.02222.x ; PMID: 15469496
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- A reference map of the Arabidopsis thaliana mature pollen proteome. DOI: 10.1016/j.bbrc.2005.09.185 ; PMID: 16242667
- Arabidopsis group Ie formins localize to specific cell membrane domains, interact with actin-binding proteins and cause defects in cell expansion upon aberrant expression. DOI: 10.1111/j.1469-8137.2005.01582.x ; PMID: 16313636
- Analysis of the female gametophyte transcriptome of Arabidopsis by comparative expression profiling. DOI: 10.1104/pp.105.067314 ; PMID: 16299181
- Promoter-proximal introns in Arabidopsis thaliana are enriched in dispersed signals that elevate gene expression. DOI: 10.1105/tpc.107.057190 ; PMID: 18319396
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Proteomic analyses of apoplastic proteins from germinating Arabidopsis thaliana pollen. DOI: 10.1016/j.bbapap.2011.07.013 ; PMID: 21798377
- Transcriptional dynamics of two seed compartments with opposing roles in Arabidopsis seed germination. DOI: 10.1104/pp.113.223511 ; PMID: 23858430
- A Processive Arabidopsis Formin Modulates Actin Filament Dynamics in Association with Profilin. DOI: 10.1016/j.molp.2016.03.006 ; PMID: 26996265
- Profilin promotes formin-mediated actin filament assembly and vesicle transport during polarity formation in pollen. DOI: 10.1093/plcell/koab027 ; PMID: 33638636
- Plant profilin isovariants are distinctly regulated in vegetative and reproductive tissues. DOI: 10.1002/cm.10029 ; PMID: 11977080
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- A reference map of the Arabidopsis thaliana mature pollen proteome. DOI: 10.1016/j.bbrc.2005.09.185 ; PMID: 16242667
- Arabidopsis group Ie formins localize to specific cell membrane domains, interact with actin-binding proteins and cause defects in cell expansion upon aberrant expression. DOI: 10.1111/j.1469-8137.2005.01582.x ; PMID: 16313636
- Distinct roles of the first introns on the expression of Arabidopsis profilin gene family members. DOI: 10.1104/pp.105.071316 ; PMID: 16361517
- Class-specific interaction of profilin and ADF isovariants with actin in the regulation of plant development. DOI: 10.1105/tpc.107.052621 ; PMID: 17933902
Gene Resources
- UniProt: A0A384KP50
- EMBL: CACRSJ010000109, CACSHJ010000095, LUHQ01000004
- AlphaFoldDB: A0A384KP50
- EnsemblPlants: AT4G29340.1
- Gramene: AT4G29340.1
- KEGG: ath:AT4G29340
- Orthologous matrix: YICLYAE
- ExpressionAtlas: AT4G29340
- InterPro: IPR005455, IPR027310, IPR036140
- PANTHER: PTHR11604, PTHR11604:SF26
- SUPFAM: SSF55770
- PROSITE: PS00414
- Gene3D: 3.30.450.30
- OrthoDB: A0A384KP50
- SWISS-MODEL: A0A384KP50
- Conserved Domain Database: cd00148
Sequences
cDNA Sequence
- >AT4G29340.1
TGGCTAACAAGATTACGACTAACGAGTAAATAATCATTCCTTCGGTCCTTCCTCTAAAATGCCGTTGGTGATCGTTTATAAATAGGGGAAATAGGAAAAGGGAAGAAAGTAGACGTGGCAAATAGCGAAACAATGATTGAGCTATAACAAAGGCGAAACTTGAGCGGCACTAATTGAAAATCACTCCTTGTTTTTTTGAAGAAAAAGTAAGATGTAGGGCTGAGAATTCGTCTATGTGATCCAACGGTTTTAAAATGATCCTTGTTCCTTCCTCTCCTATTTATCTGAAGGACGAAGTCCCCACGCTGCACATAACCGGGGCACTTAACGTATAGATCATAAACAAAGAAGAAGAAAAAAAATAAGAAAAGAAGAAGAAGATGTCGTGGCAAACTTACGTTGATGAGCATTTGATGTGTGATGTTGGCGATGGTCAAGGACACCACCTTACTGCTGCCGCTATCGTTGGTCATGACGGTAGCGTTTGGGCTCAGAGCGCCAACTTCCCTCAGTTCAAGGGACAGGAGTTCAGTGATATTATGAAAGATTTCGACGAACCGGGTCACTTGGCACCCACGGGATTATTCATGGCAGGAGCAAAGTACATGGTGATCCAAGGTGAGCCCGGGGCTGTAATCCGTGGCAAGAAGGGAGCAGGAGGCATAACGATAAAGAAAACAGGACAGTCATGTGTGTTTGGGATCTATGAAGAGCCAGTGACACCAGGACAGTGCAACATGGTCGTCGAGAGGTTGGGTGATTACCTCCTCGAACAGGGTCTCTAGAATCTTCTTACAATGTTCCACCACCTACATTTTTTTATAAGGCCATTGTTTCTCCTATTTTTTTCCTTTGGGTGATTTGCATCTCTTTCTCTAATTGATATTATAAGTTTTGGGCTAATGGACCTTCCTGGTTTCTCCCCATAGCAAACTTTTAAGAAAGCTGAAGCCTAAAAGGCTTTTACTCTCTTTGCCTTGGTTTCTTATTTATATGCATGTTTTAGTTGTTTTCTC
CDS Sequence
Protein Sequence