Information report for AT4G28720
Gene Details
|
|
Functional Descriptions
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- CS69869 — Disruption of shade avoidance response reflected in failure to increase hypocotyl and petiole length under end-of-the-day far-red light treatment and under low red to far-red conditions. Reduced fertility.
- CS69942 — Reduced hypocotyl and petiole length under end-of-day far-red light treatment (EOD-FR). Slight reduction in hypocotyl length under both high and low red to far-red (R:FR) conditions.
- atbs5-D/bri1-301 — Wild type rosette. bri loss of function phenotype is suppressed.
Literature and News
- A genomic analysis of the shade avoidance response in Arabidopsis. DOI: 10.1104/pp.103.034397 ; PMID: 14645734
- Interaction of auxin and ERECTA in elaborating Arabidopsis inflorescence architecture revealed by the activation tagging of a new member of the YUCCA family putative flavin monooxygenases. DOI: 10.1104/pp.105.063495 ; PMID: 16126863
- Comparison between a coffee single copy chromosomal region and Arabidopsis duplicated counterparts evidenced high level synteny between the coffee genome and the ancestral Arabidopsis genome. DOI: 10.1007/s11103-007-9191-6 ; PMID: 17551672
- REVEILLE1, a Myb-like transcription factor, integrates the circadian clock and auxin pathways. DOI: 10.1073/pnas.0813035106 ; PMID: 19805390
- Activation-tagged suppressors of a weak brassinosteroid receptor mutant. DOI: 10.1093/mp/ssp099 ; PMID: 19995721
- PIF4-mediated activation of YUCCA8 expression integrates temperature into the auxin pathway in regulating arabidopsis hypocotyl growth. DOI: 10.1371/journal.pgen.1002594 ; PMID: 22479194
- Soluble carbohydrates regulate auxin biosynthesis via PIF proteins in Arabidopsis. DOI: 10.1105/tpc.112.104794 ; PMID: 23209113
- The jasmonic acid signaling pathway is linked to auxin homeostasis through the modulation of YUCCA8 and YUCCA9 gene expression. DOI: 10.1111/tpj.12152 ; PMID: 23425284
- YUCCA8 and YUCCA9 overexpression reveals a link between auxin signaling and lignification through the induction of ethylene biosynthesis. DOI: 10.4161/psb.26363 ; PMID: 24022251
- Auxin overproduction in shoots cannot rescue auxin deficiencies in Arabidopsis roots. DOI: 10.1093/pcp/pcu039 ; PMID: 24562917
- FCA mediates thermal adaptation of stem growth by attenuating auxin action in Arabidopsis. DOI: 10.1038/ncomms6473 ; PMID: 25400039
- The importance of localized auxin production for morphogenesis of reproductive organs and embryos in Arabidopsis. DOI: 10.1093/jxb/erv256 ; PMID: 26019252
- Auxin Import and Local Auxin Biosynthesis Are Required for Mitotic Divisions, Cell Expansion and Cell Specification during Female Gametophyte Development in Arabidopsis thaliana. DOI: 10.1371/journal.pone.0126164 ; PMID: 25970627
- YUCCA-mediated auxin biogenesis is required for cell fate transition occurring during de novo root organogenesis in Arabidopsis. DOI: 10.1093/jxb/erw213 ; PMID: 27255928
- YUCCA auxin biosynthetic genes are required for Arabidopsis shade avoidance. DOI: 10.7717/peerj.2574 ; PMID: 27761349
- SUPPRESSOR OF PHYTOCHROME B4-#3 Represses Genes Associated with Auxin Signaling to Modulate Hypocotyl Growth. DOI: 10.1104/pp.16.00405 ; PMID: 27342309
- Functional roles of Arabidopsis CKRC2/YUCCA8 gene and the involvement of PIF4 in the regulation of auxin biosynthesis by cytokinin. DOI: 10.1038/srep36866 ; PMID: 27827441
- Auxin signaling through SCF(TIR1/AFBs) mediates feedback regulation of IAA biosynthesis. DOI: 10.1080/09168451.2017.1313694 ; PMID: 28406060
- POWERDRESS-mediated histone deacetylation is essential for thermomorphogenesis in Arabidopsis thaliana. DOI: 10.1371/journal.pgen.1007280 ; PMID: 29547672
- Class I TCP Transcription Factors Target the Gibberellin Biosynthesis Gene GA20ox1 and the Growth-Promoting Genes HBI1 and PRE6 during Thermomorphogenic Growth in Arabidopsis. DOI: 10.1093/pcp/pcz137 ; PMID: 31292642
- An Improved Recombineering Toolset for Plants. DOI: 10.1105/tpc.19.00431 ; PMID: 31666295
- Arabidopsis thaliana SURFEIT1-like genes link mitochondrial function to early plant development and hormonal growth responses. DOI: 10.1111/tpj.14762 ; PMID: 32248588
- ZEITLUPE enhances expression of PIF4 and YUC8 in the upper aerial parts of Arabidopsis seedlings to positively regulate hypocotyl elongation. DOI: 10.1007/s00299-020-02643-8 ; PMID: 33386962
- Jasmonic Acid-Dependent MYC Transcription Factors Bind to a Tandem G-Box Motif in the YUCCA8 and YUCCA9 Promoters to Regulate Biotic Stress Responses. DOI: 10.3390/ijms22189768 ; PMID: 34575927
- High temperature perception in leaves promotes vascular regeneration and graft formation in distant tissues. DOI: 10.1242/dev.200079 ; PMID: 35217857
- MEDIATOR SUBUNIT17 integrates jasmonate and auxin signaling pathways to regulate thermomorphogenesis. DOI: 10.1093/plphys/kiac220 ; PMID: 35567489
- PIF4 enhances DNA binding of CDF2 to co-regulate target gene expression and promote Arabidopsis hypocotyl cell elongation. DOI: 10.1038/s41477-022-01213-y ; PMID: 35970973
- Tonoplast proton pumps regulate nuclear spacing of female gametophytes via mediating polar auxin transport in Arabidopsis. DOI: 10.3389/fpls.2022.1006735 ; PMID: 36176689
- Endogenous auxin maintains embryonic cell identity and promotes somatic embryo development in Arabidopsis. DOI: 10.1111/tpj.16024 ; PMID: 36345646
- A genome-wide association study identifies novel players in Na and Fe homeostasis in Arabidopsis thaliana under alkaline-salinity stress. DOI: 10.1111/tpj.16042 ; PMID: 36433704
- and transport-mediated dynamic auxin distribution during seed development controls seed size in Arabidopsis. DOI: 10.1111/tpj.16109 ; PMID: 36648165
- REVEILLE1, a Myb-like transcription factor, integrates the circadian clock and auxin pathways. DOI: 10.1073/pnas.0813035106 ; PMID: 19805390
Gene Resources
- UniProt: A0A178V2K9
- EMBL: CACRSJ010000109, CACSHJ010000095, LR881469
- AlphaFoldDB: A0A178V2K9
- EnsemblPlants: AT4G28720.1
- Gramene: AT4G28720.1
- KEGG: ath:AT4G28720
- Orthologous matrix: NTMGKTP
- ExpressionAtlas: AT4G28720
- InterPro: IPR020946, IPR036188, IPR050982
- PANTHER: PTHR43539, PTHR43539:SF11
- SUPFAM: SSF51905
- Gene3D: 3.50.50.60
- OrthoDB: A0A178V2K9
- SWISS-MODEL: A0A178V2K9
Sequences
cDNA Sequence
- >AT4G28720.1
ATTCCAAATTCAAAACCATTTCCAATACAACTTCCATTGATTCTCTCTCTCTCTCTCTCTACTAAAACTTTCAAATTCTCTTACTTTCAATACTTATTAAAGAAACTTATAAAAAAAGAATGGAGAATATGTTTCGTTTGATGGATCAAGATCAGGATTTAACTAATAACCGGTGCATTTGGGTCAACGGACCGGTCATCGTCGGAGCTGGACCGTCGGGGTTAGCGACGGCGGCTTGTCTCCATGAACAAAACGTTCCTTTCGTTGTTCTCGAGAGAGCAGATTGTATTGCTTCTCTATGGCAAAAACGTACTTACGATCGTCTCAAGCTTCACCTTCCTAAGCAGTTTTGTCAATTACCGAAAATGCCCTTCCCTGAGGACTTCCCGGAGTACCCGACGAAGCGTCAGTTCATCGACTACCTTGAGTCTTACGCTACCCGGTTCGAGATCAACCCTAAGTTCAACGAGTGTGTGCAGACTGCTCGGTTCGATGAGACCAGTGGCTTGTGGCGAGTCAAGACCGTGTCGAAGAGTGAGTCGACTCAGACCGAGGTCGAGTATATTTGCCGGTGGCTTGTGGTGGCTACGGGAGAAAATGCGGAGAGAGTGATGCCGGAGATTGATGGTCTTTCTGAGTTTTCCGGTGAGGTGATTCACGCTTGTGATTACAAGTCCGGCGAGAAATTCGCCGGGAAAAAAGTTCTCGTCGTTGGTTGTGGAAACTCCGGCATGGAAGTTTCTCTTGACCTAGCAAACCATTTCGCTAAGCCTTCCATGGTCGTGAGAAGCTCTCTTCACGTGATGCCGAGGGAAGTAATGGGTAAATCAACGTTTGAGCTTGCAATGAAGATGTTAAGATGGTTTCCTCTATGGTTAGTCGACAAGATATTGTTGGTTTTAAGTTGGATGGTTCTTGGAAACATCGAGAAATACGGTTTGAAACGACCAGAGATGGGTCCAATGGAGCTAAAAAGCGTGAAAGGCAAGACACCGGTGCTTGACATCGGAGCTATAGAGAAGATCCGGTTAGGAAAGATCAACGTGGTTCCAGGGATCAAAAGGTTTAACGGAAACAAAGTCGAACTTGTCAATGGAGAACAACTAGACGTAGACTCAGTTGTTCTAGCTACTGGTTACCGCAGCAACGTCCCATATTGGCTACAAGAGAATGAGTTCTTTGCAAAGAATGGTTTCCCAAAGACAGTAGCTGACAACAATGGTTGGAAAGGAAGGACAGGATTGTATGCGGTTGGGTTTACGAGGAAAGGGCTCTCAGGTGCGTCAATGGACGCGGTTAAGATCGCACAAGACATAGGCTCTGTTTGGCAACTTGAAACAAAACAACCCACGAAACGCTCAAGGGGTTCTCTTCGAAGGTGTATCTCTCAACAGTTCTAATTTTTAGGAAAAAAAAGATTAGAGTTTTAGGACAGAGATCACTGACAAAAGAGAAGAGCCCTCTCCTGAAGACCCAAAGCGAATCAAAGGGTGTTGTGCGTGTTTTTTTGTTACCTCCTCCACTTAGTGTTTTGGGCGTTTTGTGTAAACAGAGGAAGATGTGGCCTTTTGTTTTCTACTTTTTTACAATCTTTTTTTTTACATACATTTTTAACAATTATTTTTTGGGGGTGGGTTCTTTGATTTTTTTGTACAAGTTTATGTTAACATCTATATTGTATACACTTTTCTATTTTTTTTTAAGCCAAATATATTTTGATTTCAATTTACCATC
CDS Sequence
Protein Sequence