Gene Details:
- Gene ID: AT4G28500
- Gene Symbol: ANAC073, NAC073, SND2
- Gene Name: NAC domain containing protein 73, NAC domain containing protein 73, SECONDARY WALL-ASSOCIATED NAC DOMAIN PROTEIN 2
- Description: NAC domain containing protein 73;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
Function-related keywords:
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DOI: 10.1093/dnares/10.6.239 ; PMID: 15029955
- The xylem and phloem transcriptomes from secondary tissues of the Arabidopsis root-hypocotyl. DOI: 10.1104/pp.105.060202 ; PMID: 15923329
- Biosynthesis of cellulose-enriched tension wood in Populus: global analysis of transcripts and metabolites identifies biochemical and developmental regulators in secondary wall biosynthesis. DOI: 10.1111/j.1365-313X.2005.02584.x ; PMID: 16367961
- SND1, a NAC domain transcription factor, is a key regulator of secondary wall synthesis in fibers of Arabidopsis. DOI: 10.1105/tpc.106.047399 ; PMID: 17114348
- ANAC012, a member of the plant-specific NAC transcription factor family, negatively regulates xylary fiber development in Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2007.03109.x ; PMID: 17565617
- The MYB46 transcription factor is a direct target of SND1 and regulates secondary wall biosynthesis in Arabidopsis. DOI: 10.1105/tpc.107.053678 ; PMID: 17890373
- CressExpress: a tool for large-scale mining of expression data from Arabidopsis. DOI: 10.1104/pp.107.115535 ; PMID: 18467456
- AtERF38 (At2g35700), an AP2/ERF family transcription factor gene from Arabidopsis thaliana, is expressed in specific cell types of roots, stems and seeds that undergo suberization. DOI: 10.1016/j.plaphy.2008.07.003 ; PMID: 18723362
- A highly efficient miPCR method for isolating FSTs from transgenic Arabidopsis thaliana plants. DOI: 10.1007/s12041-008-0020-8 ; PMID: 18776641
- A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis. DOI: 10.1105/tpc.108.061325 ; PMID: 18952777
- Characterization of NAC domain transcription factors implicated in control of vascular cell differentiation in Arabidopsis and Populus. DOI: 10.1007/s00425-010-1181-2 ; PMID: 20458494
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- Enhanced Y1H assays for Arabidopsis. DOI: 10.1038/nmeth.1750 ; PMID: 22037706
- SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre cell area in Eucalyptus. DOI: 10.1186/1471-2229-11-173 ; PMID: 22133261
- Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels. DOI: 10.1371/journal.pone.0105726 ; PMID: 25148240
- Promoter-based integration in plant defense regulation. DOI: 10.1104/pp.114.248716 ; PMID: 25352272
- Reconstitution of a secondary cell wall in a secondary cell wall-deficient Arabidopsis mutant. DOI: 10.1093/pcp/pcu208 ; PMID: 25535195
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- Transcriptional Regulation of Arabidopsis Polycomb Repressive Complex 2 Coordinates Cell-Type Proliferation and Differentiation. DOI: 10.1105/tpc.15.00744 ; PMID: 27650334
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- A PXY-Mediated Transcriptional Network Integrates Signaling Mechanisms to Control Vascular Development in Arabidopsis. DOI: 10.1105/tpc.19.00562 ; PMID: 31806676
- Xylem vessel-specific SND5 and its homologs regulate secondary wall biosynthesis through activating secondary wall NAC binding elements. DOI: 10.1111/nph.17425 ; PMID: 33908063
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
Sequences:
cDNA Sequence
- >AT4G28500.1
AACATTTGTACACATTATAAAAATGAGGTTTAAATAATATTTCTTCTAGGATTATCTCATCTCTCTCTTTCATGGATAGTACAGAGTTAAAATCAAGTGCAAAAAGGGGCAATTATCTCAGCTTAAAAAAGTGATGAACAAGAATTTAATTCCTTCCTCTTTCTCAAGATAACCTCAAAGAGATCTTCTTATGAAACATATGCTTTAGCTATCTTTAACCCTTTTTCCCTTCTCTCTTTCTATTTCTCCCTCATACCTTTGTTTATTCTGATGAAGTTGTGAGCACTGAAAGAAAAGAAGAGAGGAGAAGAGAGATATGCACAAGAAGAATTAAACTTAGGGACACAAAACAACATGACTTGGTGCAATGACCGTAGCGATGTTCAGACCGTTGAAAGAATCATTCCCTCCCCGGGGGCGGCTGAGTCCCCCGTAGCCTCACTTCCGGTCTCTTGTCACAAAACTTGCCCTTCTTGTGGCCATAACTTCAAGTTTCACGAACAGGCTGGGATCCATGACTTGCCGGGACTTCCTGCTGGAGTAAAATTTGATCCGACGGATCAAGAGGTCTTGGAGCATCTTGAAGGCAAGGTAAGAGATGACGCAAAAAAGCTTCATCCTCTCATTGATGAGTTTATCCGTACCATCGATGGTGAAAACGGCATTTGTTATACCCATCCTGAAAAATTGCCAGGAGTGAACAAGGACGGGACGGTGCGTCATTTCTTCCACCGACCGTCGAAGGCATACACGACGGGAACAAGAAAGCGACGTAAAGTCCACACTGATTCTGACGTCGGTGGAGAGACACGGTGGCACAAGACAGGAAAAACACGGCCAGTTCTTGCTGGAGGAAGAGTGAGAGGCTACAAGAAAATCCTAGTGCTCTACACAAACTACGGCAAACAAAAAAAACCCGAGAAGACTAATTGGGTAATGCATCAATATCATCTTGGCACTAGCGAGGAAGAGAAAGAAGGTGAGCTCGTCGTCTCCAAAGTCTTTTACCAGACTCAACCACGTCAATGCGGTGGCTCCGTTGCTGCTGCAGCCACCGCTAAGGACCGACCTTACCTCCACGGCCTCGGTGGAGGTGGTGGCCGCCACCTTCATTACCATCTTCATCATAACAACGGTAACGGTAAGAGCAACGGCAGTGGGGGAACCGCCGGAGCCGGTGAGTATTATCACAATATTCCGGCTATTATCTCGTTCAATCAGACCGGGATACAGAACCACTTGGTTCATGACTCTCAACCTTTTATCCCTTAAAAACAAAATGATTTTATATCAACGATCCTAAAATAAAACAAACGGTATATAATCTAAGCATTATCTTTGATATACACATACATATATACGTTGAAAATAATTTAAAATTTACAGTGCATTCTTGTATTCGTAACTTGTTTTTTGTTTCTCTTAATTCTTTTTTCCTTTTGATTTTACGGCTTTGTACAATTTAAATTCCTTGGACTGAGACTGACCATGAAAAATATGTACAAAGATCTCCATTGGCTATTGACTATTGTTACATGAATTCATTTTGATATCTTGTC
CDS Sequence
Protein Sequence