Gene Details:
- Gene ID: AT4G28395
- Gene Symbol: A7, ATA7
- Gene Name: ANTHER 7, ARABIDOPSIS THALIANA ANTHER 7
- Description: Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
Function-related keywords:
Literature:
- Identification, sequence analysis and expression studies of novel anther-specific genes of Arabidopsis thaliana. DOI: 10.1023/a:1005964431302 ; PMID: 9687065
- The eight-cysteine motif, a versatile structure in plant proteins. DOI: 10.1016/j.plaphy.2004.03.009 ; PMID: 15191737
- Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR KINASES1 and 2 are essential for tapetum development and microspore maturation. DOI: 10.1105/tpc.105.036731 ; PMID: 16284306
- Comparative gene mapping in Arabidopsis lyrata chromosomes 6 and 7 and A. thaliana chromosome IV: evolutionary history, rearrangements and local recombination rates. DOI: 10.1017/S0016672306008287 ; PMID: 17014743
- Genome-wide analysis of the rice and Arabidopsis non-specific lipid transfer protein (nsLtp) gene families and identification of wheat nsLtp genes by EST data mining. DOI: 10.1186/1471-2164-9-86 ; PMID: 18291034
- An extensive (co-)expression analysis tool for the cytochrome P450 superfamily in Arabidopsis thaliana. DOI: 10.1186/1471-2229-8-47 ; PMID: 18433503
- The ABORTED MICROSPORES regulatory network is required for postmeiotic male reproductive development in Arabidopsis thaliana. DOI: 10.1105/tpc.109.071803 ; PMID: 20118226
- Acyl-lipid metabolism. DOI: 10.1199/tab.0161 ; PMID: 23505340
- Abundant type III lipid transfer proteins in Arabidopsis tapetum are secreted to the locule and become a constituent of the pollen exine. DOI: 10.1104/pp.113.225706 ; PMID: 24096413
- Identification, sequence analysis and expression studies of novel anther-specific genes of Arabidopsis thaliana. DOI: 10.1023/a:1005964431302 ; PMID: 9687065
Sequences:
cDNA Sequence
- >AT4G28395.1
ATCCGAGTAAGAAGGAAACATGAGAACTACATGTGTTCATTAAACTAAGCCATGCATAATAAACTCCACCTTAGAAACGAATTGATTACTATATATATAATATATAGATATAGATTTCTCTTCGTACACGAATCATATATATCACCTTCGCTAGCTAGTGTACTGAGTTCAATGAAGATACATGCCATATTGGTAGTAGCGTTCTTGGTCCTGATGAAGACCGCCGTTTCCCAGGACAATAATCCGCTGGAACATTGCAGAGACGTGTTCGTGAGTTTCATGCCCTGCATGGGCTTCGTCGAGGGAATATTTCAACAACCTTCTCCAGATTGCTGCAGAGGCGTGACCCACTTGAACAACGTCGTCAAGTTTACGTCTCCAGGATCGAGGAATAGGCAGGATAGTGGAGAAACAGAGAGAGTGTGTCTGTGCATTGAGATAATGGGAAATGCAAATCATCTTCCTTTTCTTCCCGCCGCTATTAATAACCTTCCTCTCCGTTGTTCTCTTACTCTCAGCTTTCCCATCTCCGTTGATATGGACTGTTCTCAGTTCAGAAACACCAAGAATCCCGACGTTGAGAAATTAAATTAACTACCAGGATATATATCTATGAATATTGGGAAGGGAAGCCTTGTAACAGTTCTATATAGTTACAAATGATATATAATCGAGTTTATTGTAGATGTAATAGTGACTAGTGTTACAAAAGTACGAAGAATTTTCTGTAAGCGATTATATATATGTATATTCATCAGATATGGCTTC
CDS Sequence
Protein Sequence