Gene Details:

  • Gene ID: AT4G27330
  • Gene Symbol: NZZ, SPL
  • Gene Name: NOZZLE, SPOROCYTELESS
  • Description: sporocyteless (SPL);(source:Araport11)
  • TAIR Accession: locus:2131729
  • Genome: Araport11_genome_release
  • Species: Arabidopsis thaliana

Transcripts:

Plant Ontology Annotations:

  • PO:0009009  — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
  • PO:0009031  — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
  • PO:0009046  — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
  • PO:0025022  — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)

Gene Ontology:

  • GO:0005515  — enables — protein binding
  • GO:0048653  — acts upstream of or within — anther development
  • GO:0003700  — enables — DNA-binding transcription factor activity
  • GO:0005634  — located in — nucleus
  • GO:0048533  — acts upstream of or within — sporocyte differentiation

Germplasm Phenotype:

  • CS6586  — Defective in sporocyte formation (resulting in the absence of microspores and megaspores) and anther wall formation; hypodermal cells of anthers at stage 2 enlarge and differentiate into archesporial cells normally; archesporial cells undergo periclinal divisions to form the primary parietal cell (PPC) layer and the primary sporogenous cell (PSC) layer at stage 3 anthers; PSCs do not form microsporocytes, becoming vacuolated at stage 4 anthers; parietal cells are also affected, because the PPCs go through only one division to give rise to two SPC layers that fail to divide further and differentiate; there is no endothecium or tapetum formation; anthers are composed of highly vacuolated parenchyma cells at anthesis; archesporial cells fail to elongate and differentiate into megasporocytes; nucellar development but not integument development is affected. Delayed plant senescence; sterile plants (complete male and female sterility); flowers have normal external morphology and the same number of organs as wild type, anthers are white with no pollen grains at anthesis during stage 13-14; carpels look morphologically normal but are infertile when pollinated with wild-type pollen.
  • spl  — Absence of megaspores and microspores in homozygous mutant plants

Literature:

Sequences:

cDNA Sequence
  • >AT4G27330.1
    GTATATGAACACTAAAGAGATACACACACACAAAAAGAGAGCAGAAACAAAACACACACACTTAAAGCTTTCGTCTTTACCTCTTCCCTTCTCTCTCTCTATCTAAAAAGAGTTCCGAGAAGAAGATCATCATCAATGGCGACTTCTCTCTTCTTCATGTCAACAGATCAAAACTCCGTCGGAAACCCAAACGATCTTCTGAGAAACACCCGTCTTGTCGTCAACAGCTCCGGCGAGATCCGGACAGAGACACTGAAGAGTCGTGGTCGGAAACCAGGATCGAAGACAGGTCAGCAAAAACAGAAGAAACCAACGTTGAGAGGAATGGGTGTAGCAAAGCTCGAGCGTCAGAGAATCGAAGAAGAAAAGAAGCAACTCGCCGCCGCCACAGTCGGAGACACGTCATCAGTAGCATCGATCTCTAACAACGCTACCCGTTTACCCGTACCGGTAGACCCGGGTGTTGTGCTACAAGGCTTCCCAAGCTCACTCGGGAGCAACAGGATCTATTGTGGTGGAGTCGGGTCGGGTCAGGTTATGATCGACCCGGTTATTTCTCCATGGGGTTTTGTTGAGACCTCCTCCACTACTCATGAGCTCTCTTCAATCTCAAATCCTCAAATGTTTAACGCTTCTTCCAATAATCGCTGTGACACTTGCTTCAAGAAGAAACGTTTGGATGGTGATCAGAATAATGTAGTTCGATCCAACGGTGGTGGATTTTCGAAATACACAATGATTCCTCCTCCGATGAACGGCTACGATCAGTATCTTCTTCAATCAGATCATCATCAGAGGAGCCAAGGTTTCCTTTATGATCATAGAATCGCTAGAGCAGCTTCAGTTTCTGCTTCTAGTACTACTATTAATCCTTATTTCAACGAGGCAACAAATCATACGGGACCAATGGAGGAATTTGGGAGCTACATGGAAGGAAACCCTAGAAATGGATCAGGAGGTGTGAAGGAGTACGAGTTTTTTCCGGGGAAATATGGTGAAAGAGTTTCAGTGGTGGCTAAAACGTCGTCACTCGTAGGTGATTGCAGTCCTAATACCATTGATTTGTCCTTGAAGCTTTAAATGTTTTATCTTTCTATATTGATTTAAACAAAATCGTCTCTTTAAAGAAAAAACATTTTAAGTAGATGAAAGTAAGAAACAGAAGAAAAAAAAGAGAGAGCCTTTTTTGGTGTATGCATCTGAGAGCTGAGTCGAAAGAAAGATTCAGCTTTTGGATTACCCTTTTGGTTGTTTATTATGAGATTCTAACCTAAACACTCAGACATATATGTTCTGTTCTCTTCCTTAATTGTTGTCATGAAACTTCTC
CDS Sequence
Protein Sequence