Gene Details:
- Gene ID: AT4G27150
- Gene Symbol: AT2S2, SESA2
- Gene Name: seed storage albumin 2
- Description: seed storage albumin 2;(source:Araport11)
- TAIR Accession: locus:2136472
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0005576 — located in — extracellular region
- GO:0008150 — involved in — biological_process
- GO:0003674 — enables — molecular_function
Literature:
- Redundant proteolytic mechanisms process seed storage proteins in the absence of seed-type members of the vacuolar processing enzyme family of cysteine proteases. DOI: 10.1105/tpc.005009 ; PMID: 12417707
- Comparative analysis of expressed sequence tags from Sesamum indicum and Arabidopsis thaliana developing seeds. DOI: 10.1023/b:plan.0000004304.22770.e9 ; PMID: 14682612
- Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. DOI: 10.1105/tpc.104.022699 ; PMID: 15319476
- Genome-wide profiling of stored mRNA in Arabidopsis thaliana seed germination: epigenetic and genetic regulation of transcription in seed. DOI: 10.1111/j.1365-313X.2005.02337.x ; PMID: 15703057
- The eight-cysteine motif, a versatile structure in plant proteins. DOI: 10.1016/j.plaphy.2004.03.009 ; PMID: 15191737
- Characterization of a novel putative zinc finger gene MIF1: involvement in multiple hormonal regulation of Arabidopsis development. DOI: 10.1111/j.1365-313X.2005.02626.x ; PMID: 16412086
- Computational and experimental analysis identifies Arabidopsis genes specifically expressed during early seed development. DOI: 10.1186/1471-2164-7-38 ; PMID: 16504176
- The turnip mutant of Arabidopsis reveals that LEAFY COTYLEDON1 expression mediates the effects of auxin and sugars to promote embryonic cell identity. DOI: 10.1104/pp.106.080895 ; PMID: 16935993
- Proteomic and transcriptomic analysis of Arabidopsis seeds: molecular evidence for successive processing of seed proteins and its implication in the stress response to sulfur nutrition. DOI: 10.1111/j.1365-313X.2006.02900.x ; PMID: 17059406
- The proteolytic processing of seed storage proteins in Arabidopsis embryo cells starts in the multivesicular bodies. DOI: 10.1105/tpc.106.040931 ; PMID: 17012602
- MAIGO2 is involved in exit of seed storage proteins from the endoplasmic reticulum in Arabidopsis thaliana. DOI: 10.1105/tpc.106.046151 ; PMID: 17194767
- An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library. DOI: 10.1186/1471-2229-7-42 ; PMID: 17672910
- Analysis of the Arabidopsis histidine kinase ATHK1 reveals a connection between vegetative osmotic stress sensing and seed maturation. DOI: 10.1105/tpc.107.055871 ; PMID: 18441212
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- Synergistic repression of the embryonic programme by SET DOMAIN GROUP 8 and EMBRYONIC FLOWER 2 in Arabidopsis seedlings. DOI: 10.1093/jxb/err383 ; PMID: 22162868
Sequences:
cDNA Sequence
- >AT4G27150.1
AAACCAAAACTCATCATCACAAACGAGTAAGAATACAAACACAAATAGCAAAAAAATGGCAAACAAGCTCTTCCTCGTCTGCGCAACTTTCGCCCTCTGCTTCCTCCTCACCAACGCTTCCATCTACCGCACTGTTGTCGAGTTCGACGAAGATGACGCCAGCAACCCCATGGGCCCAAGACAGAAATGTCAGAAGGAGTTTCAGCAATCACAGCACCTAAGAGCTTGCCAGAAATTGATGCGCATGCAAATGAGGCAAGGCCGTGGTGGTGGTCCCTCCCTCGACGATGAGTTCGATTTGGAAGACGACATCGAGAACCCACAAGGCCCCCAGCAGGGACACCAGATCCTCCAGCAGTGCTGCAGCGAGCTTCGCCAGGAAGAGCCAGTTTGTGTTTGCCCCACCTTGAGACAAGCTGCCAGGGCCGTTAGCCTCCAGGGACAACACGGACCATTCCAATCCAGGAAAATTTACAAGACAGCTAAGTACTTGCCTAACATTTGCAAGATCCAGCAAGTTGGTGAATGCCCCTTCCAGACCACCATCCCTTTCTTCCCTCCTTACTAATAGATTCCAAACAAAAACCCTCGAGCGTATGAGAGTGTGGTTGTTGATACATGTTAACACCACACCTCATCGTGTCTTTTATGAAAATGTAAGTTTTGGATGTTTGAGGCTAAATGTATTTAGCACAAGTCCTTAATAAATAAGAGTTTTGTTTATGTTTCATTTTC
CDS Sequence
Protein Sequence