Information report for AT4G27140
Gene Details
|
|
Functional Descriptions
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- GO:0005576 — located in — extracellular region
- GO:0048316 — acts upstream of or within — seed development
- GO:0016053 — acts upstream of or within — organic acid biosynthetic process
- GO:0006952 — acts upstream of or within — defense response
- GO:0032787 — acts upstream of or within — monocarboxylic acid metabolic process
- GO:0071695 — acts upstream of or within — anatomical structure maturation
- GO:0009753 — acts upstream of or within — response to jasmonic acid
- GO:0009611 — acts upstream of or within — response to wounding
- GO:0009266 — acts upstream of or within — response to temperature stimulus
- GO:0071396 — acts upstream of or within — cellular response to lipid
- GO:1901701 — acts upstream of or within — cellular response to oxygen-containing compound
- GO:0006629 — acts upstream of or within — lipid metabolic process
Functional Keywords
Literature and News
- Contrapuntal networks of gene expression during Arabidopsis seed filling. DOI: 10.1105/tpc.000877 ; PMID: 12084821
- Redundant proteolytic mechanisms process seed storage proteins in the absence of seed-type members of the vacuolar processing enzyme family of cysteine proteases. DOI: 10.1105/tpc.005009 ; PMID: 12417707
- Viviparous1 alters global gene expression patterns through regulation of abscisic acid signaling. DOI: 10.1104/pp.103.022475 ; PMID: 12857845
- Comparative analysis of expressed sequence tags from Sesamum indicum and Arabidopsis thaliana developing seeds. DOI: 10.1023/b:plan.0000004304.22770.e9 ; PMID: 14682612
- Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. DOI: 10.1105/tpc.104.022699 ; PMID: 15319476
- The eight-cysteine motif, a versatile structure in plant proteins. DOI: 10.1016/j.plaphy.2004.03.009 ; PMID: 15191737
- Characterization of a novel putative zinc finger gene MIF1: involvement in multiple hormonal regulation of Arabidopsis development. DOI: 10.1111/j.1365-313X.2005.02626.x ; PMID: 16412086
- Delayed embryo development in the ARABIDOPSIS TREHALOSE-6-PHOSPHATE SYNTHASE 1 mutant is associated with altered cell wall structure, decreased cell division and starch accumulation. DOI: 10.1111/j.1365-313X.2006.02662.x ; PMID: 16553896
- Proteomic and transcriptomic analysis of Arabidopsis seeds: molecular evidence for successive processing of seed proteins and its implication in the stress response to sulfur nutrition. DOI: 10.1111/j.1365-313X.2006.02900.x ; PMID: 17059406
- MAIGO2 is involved in exit of seed storage proteins from the endoplasmic reticulum in Arabidopsis thaliana. DOI: 10.1105/tpc.106.046151 ; PMID: 17194767
- An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library. DOI: 10.1186/1471-2229-7-42 ; PMID: 17672910
- Analysis of the Arabidopsis histidine kinase ATHK1 reveals a connection between vegetative osmotic stress sensing and seed maturation. DOI: 10.1105/tpc.107.055871 ; PMID: 18441212
- Synergistic repression of the embryonic programme by SET DOMAIN GROUP 8 and EMBRYONIC FLOWER 2 in Arabidopsis seedlings. DOI: 10.1093/jxb/err383 ; PMID: 22162868
Gene Resources
- UniProt: A0A178UXL9
- EMBL: CACSHJ010000095, LUHQ01000004
- AlphaFoldDB: A0A178UXL9
- EnsemblPlants: AT4G27140.1
- Gramene: AT4G27140.1
- KEGG: ath:AT4G27140
- Orthologous matrix: QPMQVRK
- ExpressionAtlas: AT4G27140
- InterPro: IPR000617, IPR016140, IPR036312
- PANTHER: PTHR35496, PTHR35496:SF20
- SUPFAM: SSF47699
- Gene3D: 1.10.110.10
- OrthoDB: A0A178UXL9
- SWISS-MODEL: A0A178UXL9
- Conserved Domain Database: cd00261
Sequences
cDNA Sequence
- >AT4G27140.1
TCACTCGAACCAAAACATACACACATAGCAAAAAATGGCAAACAAGTTGTTCCTCGTCTGCGCAGCTCTCGCTCTCTGCTTCCTCCTCACCAACGCTTCCATCTACCGCACCGTCGTTGAGTTCGAAGAAGATGACGCCACTAACCCCATAGGCCCAAAAATGAGGAAATGCCGCAAGGAGTTTCAGAAAGAACAACACCTAAGAGCTTGCCAGCAATTGATGCTCCAGCAAGCAAGGCAAGGCCGTAGCGATGAGTTTGATTTCGAAGACGACATGGAGAACCCACAGGGACAACAGCAGGAACAACAGCTATTCCAGCAGTGCTGCAACGAGCTTCGCCAGGAAGAGCCAGATTGTGTTTGCCCCACCTTGAAACAAGCTGCCAAGGCCGTTAGACTCCAGGGACAGCACCAACCAATGCAAGTCAGGAAAATTTACCAGACAGCCAAGCACTTGCCCAACGTTTGCGACATCCCGCAAGTTGATGTTTGTCCCTTCAACATCCCTTCATTCCCTTCTTTCTACTAAATCTCAAACAAACCCTCAAAGCGTATGAGAGTGTGGTTGTTGATATATACATGTTGACACTTGACACATACCACACCTCATCGTGTGTTTTATGATAAATGTAAGCTTTTGGATGTTTGAGGGTAATGTAAGCACTACTTAATAAATAAGAGTTTTGTTTATATTTTTTTTGTT
CDS Sequence
Protein Sequence