Information report for AT4G26466
Gene Details
|
|
Functional Descriptions
- CS66101 — Reduced seed set.
- CS66102 — Reduced seed set due to defects in pollen tube reception, double fertilization and early seed development.
- CS66103 — Reduced seed set.
- CS66104 — Reduced seed set.
- CS66107 — Reduced seed set due to defects in pollen tube reception, double fertilization and early seed development.
- CS69692 — No visible phenotype. The cYFP is expressed in synergid cells.
- CS69693 — No visible phenotype. The cYFP is expressed in synergid cells.
- CS69694 — No visible phenotype. The cYFP is expressed in synergid cells.
- CS69695 — No visible phenotype. The cYFP is expressed in synergid cells.
- CS69696 — No visible phenotype. The cYFP is expressed in synergid cells.
- CS69697 — No visible phenotype. The cYFP is expressed in synergid cells.
- CS69698 — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
- CS69699 — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
- CS69700 — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
- CS69701 — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
- CS69702 — No visible phenotype. The cYFP is expressed in synergid cells.
- CS69703 — No visible phenotype. The cYFP is expressed in synergid cells.
- CS69704 — No visible phenotype. The cYFP is expressed in synergid cells.
- CS69705 — Reduced seed set. The cYFP is expressed in synergid cells.
- CS69706 — Reduced seed set. The cYFP is expressed in synergid cells.
- CS69707 — Reduced seed set. The cYFP is expressed in synergid cells.
- CS69708 — Reduced seed set. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
- CS69709 — Reduced seed set. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
- CS69710 — Reduced seed set. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
- CS69717 — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
- CS69718 — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
- lre-1/+ — Approximately 20% of embryo sacs show invasion by multiple pollen tubes. About 25% of embryo sacs abort. Morphology and development of the embryo sacs appears normal.
Functional Keywords
Literature and News
- Maternal control of male-gamete delivery in Arabidopsis involves a putative GPI-anchored protein encoded by the LORELEI gene. DOI: 10.1105/tpc.108.061713 ; PMID: 19028964
- A role for LORELEI, a putative glycosylphosphatidylinositol-anchored protein, in Arabidopsis thaliana double fertilization and early seed development. DOI: 10.1111/j.1365-313X.2010.04177.x ; PMID: 20163554
- Cellular distribution of secretory pathway markers in the haploid synergid cells of Arabidopsis thaliana. DOI: 10.1111/tpj.13848 ; PMID: 29385641
- Genome-wide identification of EMBRYO-DEFECTIVE (EMB) genes required for growth and development in Arabidopsis. DOI: 10.1111/nph.16071 ; PMID: 31334862
- AtPIG-S, a predicted Glycosylphosphatidylinositol Transamidase subunit, is critical for pollen tube growth in Arabidopsis. DOI: 10.1186/s12870-020-02587-x ; PMID: 32811442
- CrRLK1L receptor-like kinases HERK1 and ANJEA are female determinants of pollen tube reception. DOI: 10.15252/embr.201948466 ; PMID: 31867824
- A receptor-channel trio conducts Ca(2+) signalling for pollen tube reception. DOI: 10.1038/s41586-022-04923-7 ; PMID: 35794475
Gene Resources
- UniProt: A0A7G2F0U3
- EMBL: LR881469
- AlphaFoldDB: A0A7G2F0U3
- EnsemblPlants: AT4G26466.1
- Gramene: AT4G26466.1
- KEGG: ath:AT4G26466
- Orthologous matrix: RCKGPAF
- ExpressionAtlas: AT4G26466
- InterPro: IPR039307
- PANTHER: PTHR31533, PTHR31533:SF31
- SWISS-MODEL: A0A7G2F0U3
Sequences
cDNA Sequence
- >AT4G26466.1
ATGGAGCTGATATTATTATTCTTCTTTCTGATGGCACTGTTGGTATCTCTCTCCTCTTCAAGTTCCATATCGGATGGTGTGTTTGAATCACAAACCTCGGTTAGTGGAAGGAACCTTCGTCATGCCAAGAAAAAATGTGAAGTGAACTTTGAGTATATGGACTACAAGGTCTTGACAAAGAGGTGCAAAGGTCCAGCGTTTCCAGCCAAAGAATGTTGCTCTGCTTTTAAAGAATTTGCATGTCCTTACGTGAGTCAGATCAACGACATGAATAGTGATTGTGCACAGACAATGTTCAGCTACATGAATATTTATGGAAACTACCCTACTGGCCTTTTCGCTAACGAGTGCAGAGAAAGGAAAGATGGGCTTGTTTGCCCTTTACCACCTCTCTATTCACATAACCTAAACGCCTCAACTGCTGATTCGACTCCTCGTTTTATCTCGCTGTTGATCTCTGCTGCAACCGCTGTTTTTGCTTTGTTAGTGTTGACTTGATCAATCAAAGGAAATTGAAA
CDS Sequence
Protein Sequence